Transcript: Human XM_006718181.3

PREDICTED: Homo sapiens post-GPI attachment to proteins 2 (PGAP2), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PGAP2 (27315)
Length:
2451
CDS:
602..1552

Additional Resources:

NCBI RefSeq record:
XM_006718181.3
NBCI Gene record:
PGAP2 (27315)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425524 ACTTTCGGCACAACATGTATT pLKO_005 1389 CDS 100% 13.200 18.480 N PGAP2 n/a
2 TRCN0000426168 GTCCTCAAACATCACCTTTAC pLKO_005 1746 3UTR 100% 10.800 8.640 N PGAP2 n/a
3 TRCN0000061454 GCGTTGCTAGTGCTCACTTAT pLKO.1 1163 CDS 100% 13.200 9.240 N PGAP2 n/a
4 TRCN0000435086 TTCATAGGACTAATGTATTTC pLKO_005 1954 3UTR 100% 13.200 9.240 N PGAP2 n/a
5 TRCN0000412622 GAACAAGGAGCTGCTCATAAC pLKO_005 1504 CDS 100% 10.800 7.560 N PGAP2 n/a
6 TRCN0000061457 CCTGGTGTTCCACTTTGAGTA pLKO.1 910 CDS 100% 4.950 3.465 N PGAP2 n/a
7 TRCN0000061455 CGGCTTCTTCTTCTGCATCAT pLKO.1 883 CDS 100% 4.950 3.465 N PGAP2 n/a
8 TRCN0000061456 CACTGTTGTCTTAACCAACAT pLKO.1 1450 CDS 100% 0.495 0.347 N PGAP2 n/a
9 TRCN0000061453 CCATCCAGTTTCTGGCCTTTA pLKO.1 1849 3UTR 100% 10.800 6.480 N PGAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11863 pDONR223 100% 73.5% 70.8% None (many diffs) n/a
2 ccsbBroad304_11863 pLX_304 0% 73.5% 70.8% V5 (many diffs) n/a
3 TRCN0000479879 CTTACCATCGGGAACAGGAACCTC pLX_317 46.6% 73.5% 70.8% V5 (many diffs) n/a
Download CSV