Transcript: Human XM_006718249.3

PREDICTED: Homo sapiens phosphodiesterase 3B (PDE3B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE3B (5140)
Length:
2681
CDS:
386..2593

Additional Resources:

NCBI RefSeq record:
XM_006718249.3
NBCI Gene record:
PDE3B (5140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718249.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048793 GCTCGCAATATGGTGTCAGAT pLKO.1 1460 CDS 100% 4.950 6.930 N PDE3B n/a
2 TRCN0000294426 ACGGAGTATTAGTAGCTTAAT pLKO_005 1525 CDS 100% 13.200 10.560 N PDE3B n/a
3 TRCN0000048795 CCAGAGAACAGATGATTCTTT pLKO.1 1353 CDS 100% 5.625 3.375 N PDE3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718249.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06702 pDONR223 100% 65.9% 66% None (many diffs) n/a
2 ccsbBroad304_06702 pLX_304 0% 65.9% 66% V5 (many diffs) n/a
3 TRCN0000470356 GTTAATAAGAAGTCGGGGCTCCGA pLX_317 11.3% 65.9% 66% V5 (many diffs) n/a
Download CSV