Transcript: Human XM_006718266.3

PREDICTED: Homo sapiens patatin like phospholipase domain containing 2 (PNPLA2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PNPLA2 (57104)
Length:
2166
CDS:
150..1943

Additional Resources:

NCBI RefSeq record:
XM_006718266.3
NBCI Gene record:
PNPLA2 (57104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222744 CCTGCCACTCTATGAGCTTAA pLKO.1 665 CDS 100% 10.800 7.560 N PNPLA2 n/a
2 TRCN0000078194 CCAAGTTCATTGAGGTATCTA pLKO.1 349 CDS 100% 5.625 3.938 N PNPLA2 n/a
3 TRCN0000078196 GCCACTCTATGAGCTTAAGAA pLKO.1 668 CDS 100% 5.625 3.938 N PNPLA2 n/a
4 TRCN0000078197 GAATGTCATTATATCCCACTT pLKO.1 524 CDS 100% 4.050 2.835 N PNPLA2 n/a
5 TRCN0000078193 CCCTTTACTCCTGAGAACTTT pLKO.1 2041 3UTR 100% 5.625 3.375 N PNPLA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08697 pDONR223 100% 84.3% 54% None 873C>G;919_1060del;1655_1791del n/a
2 ccsbBroad304_08697 pLX_304 0% 84.3% 54% V5 873C>G;919_1060del;1655_1791del n/a
3 TRCN0000468882 TCTGTAAGCTCTGTTATACATTCA pLX_317 29.5% 84.3% 54% V5 873C>G;919_1060del;1655_1791del n/a
Download CSV