Transcript: Human XM_006718271.2

PREDICTED: Homo sapiens mitochondrial ribosomal protein L23 (MRPL23), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRPL23 (6150)
Length:
529
CDS:
92..463

Additional Resources:

NCBI RefSeq record:
XM_006718271.2
NBCI Gene record:
MRPL23 (6150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718271.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117699 AGCATGGCTCTAACAAGAGAA pLKO.1 309 CDS 100% 4.950 2.475 Y MRPL23 n/a
2 TRCN0000300705 AGCATGGCTCTAACAAGAGAA pLKO_005 309 CDS 100% 4.950 2.475 Y MRPL23 n/a
3 TRCN0000117700 CAGAAACGTGAGGATCAAGAA pLKO.1 337 CDS 100% 4.950 2.475 Y MRPL23 n/a
4 TRCN0000300645 CAGAAACGTGAGGATCAAGAA pLKO_005 337 CDS 100% 4.950 2.475 Y MRPL23 n/a
5 TRCN0000117698 GTTCCGAACCAACTTCTTCAT pLKO.1 148 CDS 100% 4.950 2.475 Y MRPL23 n/a
6 TRCN0000300646 GTTCCGAACCAACTTCTTCAT pLKO_005 148 CDS 100% 4.950 2.475 Y MRPL23 n/a
7 TRCN0000117701 CATGGAAATGACAAGGGTGGA pLKO.1 226 CDS 100% 2.160 1.080 Y MRPL23 n/a
8 TRCN0000300644 CATGGAAATGACAAGGGTGGA pLKO_005 226 CDS 100% 2.160 1.080 Y MRPL23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718271.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01426 pDONR223 100% 75.3% 64.1% None (many diffs) n/a
2 ccsbBroad304_01426 pLX_304 0% 75.3% 64.1% V5 (many diffs) n/a
3 TRCN0000466267 GAATAATCCGTTCCGCGCGCTTAT pLX_317 63.8% 75.3% 64.1% V5 (many diffs) n/a
Download CSV