Transcript: Human XM_006718521.3

PREDICTED: Homo sapiens mono-ADP ribosylhydrolase 1 (MACROD1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MACROD1 (28992)
Length:
2391
CDS:
659..1255

Additional Resources:

NCBI RefSeq record:
XM_006718521.3
NBCI Gene record:
MACROD1 (28992)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718521.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231812 GTGGAGGAGCCCAGGTATAAA pLKO_005 1073 CDS 100% 15.000 10.500 N MACROD1 n/a
2 TRCN0000231810 ATTACTTCTGCAAGGACTTTG pLKO_005 996 CDS 100% 10.800 7.560 N MACROD1 n/a
3 TRCN0000231811 CATGGAAGGAGATGGCGAAAG pLKO_005 1038 CDS 100% 6.000 4.200 N MACROD1 n/a
4 TRCN0000231809 CCGACTGGAAGGAGGCGAAAT pLKO_005 936 CDS 100% 3.600 2.520 N MACROD1 n/a
5 TRCN0000180479 GAAGAAGATCCCGACATGGAA pLKO.1 1024 CDS 100% 3.000 2.100 N MACROD1 n/a
6 TRCN0000180408 GAAATCCTTTCTGAAGGGCCT pLKO.1 952 CDS 100% 0.540 0.378 N MACROD1 n/a
7 TRCN0000183241 GAACATTACTTCTGCAAGGAT pLKO.1 992 CDS 100% 3.000 4.200 N Macrod1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718521.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11892 pDONR223 100% 32.4% 30.8% None (many diffs) n/a
2 ccsbBroad304_11892 pLX_304 0% 32.4% 30.8% V5 (many diffs) n/a
3 TRCN0000467878 CTGCCTACTGGTCGGCAGCCTAAC pLX_317 60.6% 32.4% 30.8% V5 (many diffs) n/a
Download CSV