Transcript: Human XM_006718737.4

PREDICTED: Homo sapiens synaptotagmin 12 (SYT12), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYT12 (91683)
Length:
4367
CDS:
942..2261

Additional Resources:

NCBI RefSeq record:
XM_006718737.4
NBCI Gene record:
SYT12 (91683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718737.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060221 TTCTGTATTTGGCATCGATGA pLKO.1 1706 CDS 100% 4.050 5.670 N SYT12 n/a
2 TRCN0000379646 ACGAGCAGATCGTGGGCATTT pLKO_005 1591 CDS 100% 10.800 7.560 N SYT12 n/a
3 TRCN0000381973 GAAACAGGAAGGGCCTCTTTG pLKO_005 2723 3UTR 100% 10.800 7.560 N SYT12 n/a
4 TRCN0000380786 TCAGCATTGAGGACACCTTTG pLKO_005 1288 CDS 100% 6.000 4.200 N SYT12 n/a
5 TRCN0000379792 AGCTTCGAGTCCTGCTTCATG pLKO_005 1551 CDS 100% 4.950 3.465 N SYT12 n/a
6 TRCN0000380901 GTGGCATGGGAACCACACATT pLKO_005 2176 CDS 100% 4.950 3.465 N SYT12 n/a
7 TRCN0000379604 GTTCAACGAAGCCATGATCTT pLKO_005 2042 CDS 100% 4.950 3.465 N SYT12 n/a
8 TRCN0000380001 TCATCTGGACCAACGACAAGA pLKO_005 1924 CDS 100% 4.950 3.465 N SYT12 n/a
9 TRCN0000380905 TCCTCCGTGAGCAACACCTTT pLKO_005 1416 CDS 100% 4.950 3.465 N SYT12 n/a
10 TRCN0000060220 ATTTACAGGACCAGAACAAGG pLKO.1 1813 CDS 100% 4.050 2.835 N SYT12 n/a
11 TRCN0000379676 GATCCAGAGAAATGCCTACTC pLKO_005 1616 CDS 100% 4.050 2.835 N SYT12 n/a
12 TRCN0000060222 TCTGTATTTGGCATCGATGAG pLKO.1 1707 CDS 100% 4.050 2.835 N SYT12 n/a
13 TRCN0000060219 CTATTTACAGGACCAGAACAA pLKO.1 1811 CDS 100% 4.950 2.970 N SYT12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718737.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04554 pDONR223 100% 95.8% 95.8% None 1_54del n/a
2 ccsbBroad304_04554 pLX_304 0% 95.8% 95.8% V5 1_54del n/a
3 TRCN0000472284 AACATCATACGTTCCGAATAGGCG pLX_317 24.4% 95.8% 95.8% V5 1_54del n/a
Download CSV