Transcript: Human XM_006719008.3

PREDICTED: Homo sapiens solute carrier family 6 member 13 (SLC6A13), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC6A13 (6540)
Length:
2012
CDS:
607..1686

Additional Resources:

NCBI RefSeq record:
XM_006719008.3
NBCI Gene record:
SLC6A13 (6540)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719008.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042915 CGCTTCTACGACAACATCGAA pLKO.1 1300 CDS 100% 3.000 2.400 N SLC6A13 n/a
2 TRCN0000311348 GCCATGGCCTCTTATCAAATA pLKO_005 1338 CDS 100% 13.200 9.240 N Slc6a13 n/a
3 TRCN0000042914 GCTGACCTACAACAAGAAGTA pLKO.1 1428 CDS 100% 4.950 3.465 N SLC6A13 n/a
4 TRCN0000414936 TCCTCATCCTTGGAGTATCTG pLKO_005 1130 CDS 100% 4.950 3.465 N SLC6A13 n/a
5 TRCN0000079830 GCCAGTTTGTGTGTGTAGAAA pLKO.1 1046 CDS 100% 5.625 3.375 N Slc6a13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719008.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469635 CTCGCGCCTGGTAACTGACACCCA pLX_317 22.5% 59.4% 59.3% V5 0_1ins729;285_287delCATinsAGG;991C>T n/a
Download CSV