Transcript: Human XM_006719079.1

PREDICTED: Homo sapiens microsomal glutathione S-transferase 1 (MGST1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MGST1 (4257)
Length:
1078
CDS:
82..456

Additional Resources:

NCBI RefSeq record:
XM_006719079.1
NBCI Gene record:
MGST1 (4257)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162363 CGAACAGATGACAGAGTAGAA pLKO.1 271 CDS 100% 4.950 3.960 N MGST1 n/a
2 TRCN0000280909 CGAACAGATGACAGAGTAGAA pLKO_005 271 CDS 100% 4.950 3.960 N MGST1 n/a
3 TRCN0000159257 GTACTGCAACTGCATTCTATA pLKO.1 173 CDS 100% 13.200 9.240 N MGST1 n/a
4 TRCN0000297898 GTACTGCAACTGCATTCTATA pLKO_005 173 CDS 100% 13.200 9.240 N MGST1 n/a
5 TRCN0000161073 GACTGTGTAGCATTTGGCAAA pLKO.1 226 CDS 100% 4.050 2.835 N MGST1 n/a
6 TRCN0000161269 GATGACAGAGTAGAACGTGTA pLKO.1 277 CDS 100% 4.050 2.835 N MGST1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01009 pDONR223 100% 59.8% 46.2% None (many diffs) n/a
2 ccsbBroad304_01009 pLX_304 0% 59.8% 46.2% V5 (many diffs) n/a
3 TRCN0000466615 AATTGTCATTACAGGACCGTTAGT pLX_317 87.6% 59.8% 46.2% V5 (many diffs) n/a
4 TRCN0000476092 TTGCGCCCGCGTTTGCCTGTCGCC pLX_317 87% 59.8% 46.2% V5 (many diffs) n/a
5 ccsbBroadEn_06582 pDONR223 100% 59.7% 45.7% None (many diffs) n/a
6 ccsbBroad304_06582 pLX_304 0% 59.7% 45.7% V5 (many diffs) n/a
Download CSV