Transcript: Human XM_006719226.3

PREDICTED: Homo sapiens RAB3A interacting protein (RAB3IP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB3IP (117177)
Length:
9607
CDS:
345..1877

Additional Resources:

NCBI RefSeq record:
XM_006719226.3
NBCI Gene record:
RAB3IP (117177)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416599 AGGGTTAGCAGAATGTATTAA pLKO_005 2196 3UTR 100% 15.000 21.000 N RAB3IP n/a
2 TRCN0000419478 GTCACAGCTGGATTAACTAAA pLKO_005 786 CDS 100% 13.200 18.480 N RAB3IP n/a
3 TRCN0000158127 CGTTTACGAAGCCCATCTGTT pLKO.1 924 CDS 100% 4.950 6.930 N RAB3IP n/a
4 TRCN0000151845 CGGAAATATCTAGTATCAGCT pLKO.1 727 CDS 100% 2.640 3.696 N RAB3IP n/a
5 TRCN0000154713 GTACTGATAGTCTGTCTCGTT pLKO.1 907 CDS 100% 2.640 2.112 N RAB3IP n/a
6 TRCN0000154803 GTGCTACTATAACAGAGGCTT pLKO.1 856 CDS 100% 2.640 2.112 N RAB3IP n/a
7 TRCN0000419726 TTTACAGGGTGCTACTATAAC pLKO_005 848 CDS 100% 13.200 9.240 N RAB3IP n/a
8 TRCN0000155592 CCAGAGTAAGTCCTGTAAACA pLKO.1 1643 CDS 100% 5.625 3.938 N RAB3IP n/a
9 TRCN0000156982 CAAGGAGTGAGCCTAAGACTT pLKO.1 1960 3UTR 100% 4.950 3.465 N RAB3IP n/a
10 TRCN0000154773 GTAGCTGCATTGAAGACACTT pLKO.1 1200 CDS 100% 4.950 3.465 N RAB3IP n/a
11 TRCN0000061283 GCACAATAACTCAGAATGAAA pLKO.1 5085 3UTR 100% 5.625 2.813 Y ITPR2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3981 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4086 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16081 pDONR223 0% 49.8% 49.8% None 1_768del n/a
2 ccsbBroad304_16081 pLX_304 0% 49.8% 49.8% V5 1_768del n/a
3 TRCN0000468993 CATGCTATAGCATTGACGGAGATG pLX_317 69.1% 49.8% 49.8% V5 1_768del n/a
Download CSV