Transcript: Human XM_006719237.4

PREDICTED: Homo sapiens NEDD1 gamma-tubulin ring complex targeting factor (NEDD1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEDD1 (121441)
Length:
3110
CDS:
97..1812

Additional Resources:

NCBI RefSeq record:
XM_006719237.4
NBCI Gene record:
NEDD1 (121441)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719237.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419603 TCGATCTCTTAAGGATCATAA pLKO_005 165 CDS 100% 13.200 18.480 N NEDD1 n/a
2 TRCN0000414005 TTGGTAAGCGGAGGCCTAAAT pLKO_005 103 CDS 100% 13.200 18.480 N NEDD1 n/a
3 TRCN0000414009 GATCTCTTAGTGGTGAAATTA pLKO_005 239 CDS 100% 15.000 12.000 N NEDD1 n/a
4 TRCN0000413246 CATAGGGTTGGCTAGTAATTA pLKO_005 2286 3UTR 100% 15.000 10.500 N NEDD1 n/a
5 TRCN0000412484 TTGCAAGTGGAGATGATTAAA pLKO_005 1669 CDS 100% 15.000 10.500 N NEDD1 n/a
6 TRCN0000434964 ACTTGAAGTACTCCTTGTTTA pLKO_005 329 CDS 100% 13.200 9.240 N NEDD1 n/a
7 TRCN0000427803 AGGTTTGCCTCGAAGCATAAA pLKO_005 945 CDS 100% 13.200 9.240 N NEDD1 n/a
8 TRCN0000425802 GAACTACATAGAATCAGTATT pLKO_005 1866 3UTR 100% 13.200 9.240 N NEDD1 n/a
9 TRCN0000429378 GTTCTTACTAAGTCAAGTTTA pLKO_005 739 CDS 100% 13.200 9.240 N NEDD1 n/a
10 TRCN0000430588 ACTGGGCAGTGTTTCGGATAA pLKO_005 360 CDS 100% 10.800 7.560 N NEDD1 n/a
11 TRCN0000134180 CACCATTGACTTCCATTCAAA pLKO.1 1574 CDS 100% 5.625 3.938 N NEDD1 n/a
12 TRCN0000133848 CCTGTCAATGAATTGCTCTTT pLKO.1 475 CDS 100% 4.950 3.465 N NEDD1 n/a
13 TRCN0000135678 GTGATCTAACAGCTGAGTCTA pLKO.1 1259 CDS 100% 4.950 3.465 N NEDD1 n/a
14 TRCN0000133651 GTGGCTGAAATTGAAAGACTA pLKO.1 1756 CDS 100% 4.950 3.465 N NEDD1 n/a
15 TRCN0000424395 CTGAAAGTGGAAATCTAAATA pLKO_005 1352 CDS 100% 15.000 9.000 N NEDD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719237.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04751 pDONR223 100% 86.5% 86.5% None 0_1ins267 n/a
2 ccsbBroad304_04751 pLX_304 0% 86.5% 86.5% V5 0_1ins267 n/a
3 TRCN0000479792 CCTGGGCTACGAACCGCCCCACCT pLX_317 20.8% 86.5% 86.5% V5 0_1ins267 n/a
Download CSV