Transcript: Human XM_006719275.3

PREDICTED: Homo sapiens ETS transcription factor ELK3 (ELK3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELK3 (2004)
Length:
4291
CDS:
424..1647

Additional Resources:

NCBI RefSeq record:
XM_006719275.3
NBCI Gene record:
ELK3 (2004)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013880 CCTGCGATACTATTATGACAA pLKO.1 609 CDS 100% 4.950 6.930 N ELK3 n/a
2 TRCN0000329766 ACTCGTCCTTCACCATTAATT pLKO_005 851 CDS 100% 15.000 10.500 N ELK3 n/a
3 TRCN0000013878 GCCACAATTAAGGACTCATTA pLKO.1 1657 3UTR 100% 13.200 9.240 N ELK3 n/a
4 TRCN0000329765 GCCACAATTAAGGACTCATTA pLKO_005 1657 3UTR 100% 13.200 9.240 N ELK3 n/a
5 TRCN0000013879 GCTTTCTTCAAACTCTCAGAA pLKO.1 1620 CDS 100% 4.950 3.465 N ELK3 n/a
6 TRCN0000329764 GCTTTCTTCAAACTCTCAGAA pLKO_005 1620 CDS 100% 4.950 3.465 N ELK3 n/a
7 TRCN0000013881 TGGATCAGAAACATGAGCATT pLKO.1 470 CDS 100% 4.950 3.465 N ELK3 n/a
8 TRCN0000329706 TGGATCAGAAACATGAGCATT pLKO_005 470 CDS 100% 4.950 3.465 N ELK3 n/a
9 TRCN0000013882 CTCCTCTTTAATGTTGCCAAA pLKO.1 1089 CDS 100% 4.050 2.835 N ELK3 n/a
10 TRCN0000235780 ATCAGGTTTGTGACCAATAAA pLKO_005 970 CDS 100% 15.000 9.000 N Elk3 n/a
11 TRCN0000042644 CCCTCCCTTCTGAACACAGAA pLKO.1 1175 CDS 100% 0.495 0.297 N Elk3 n/a
12 TRCN0000042645 CCCAAAGGCTTGGAAATCTCT pLKO.1 1303 CDS 100% 3.000 2.100 N Elk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00499 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00499 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471822 TACCAACAAAGCGACGGGTCCGAT pLX_317 34.7% 100% 100% V5 n/a
Download CSV