Transcript: Human XM_006719459.4

PREDICTED: Homo sapiens VPS29 retromer complex component (VPS29), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS29 (51699)
Length:
1168
CDS:
137..688

Additional Resources:

NCBI RefSeq record:
XM_006719459.4
NBCI Gene record:
VPS29 (51699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719459.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304145 ATACCATCTTCTCTGTTAATA pLKO_005 807 3UTR 100% 15.000 10.500 N VPS29 n/a
2 TRCN0000111586 GCCTTGGAAACAAACATTATT pLKO.1 560 CDS 100% 15.000 10.500 N Vps29 n/a
3 TRCN0000287955 GCCTTGGAAACAAACATTATT pLKO_005 560 CDS 100% 15.000 10.500 N Vps29 n/a
4 TRCN0000304146 ACCTATGTGTATCAGCTAATT pLKO_005 623 CDS 100% 13.200 9.240 N VPS29 n/a
5 TRCN0000304147 ATCCATGGACATCAAGTTATT pLKO_005 392 CDS 100% 13.200 9.240 N VPS29 n/a
6 TRCN0000381463 CCCTGTTGCAGAGGCAATTTG pLKO_005 438 CDS 100% 13.200 9.240 N VPS29 n/a
7 TRCN0000078596 CTTTGCACCAAAGAGAGTTAT pLKO.1 257 CDS 100% 13.200 9.240 N VPS29 n/a
8 TRCN0000078595 GCAACAGTTTGCCAGCTAAAT pLKO.1 183 CDS 100% 13.200 9.240 N VPS29 n/a
9 TRCN0000300849 GCAACAGTTTGCCAGCTAAAT pLKO_005 183 CDS 100% 13.200 9.240 N VPS29 n/a
10 TRCN0000078593 GCTTCCTGTAAACTATAAGAA pLKO.1 842 3UTR 100% 5.625 3.938 N VPS29 n/a
11 TRCN0000078597 CCTTTGCACCAAAGAGAGTTA pLKO.1 256 CDS 100% 4.950 3.465 N VPS29 n/a
12 TRCN0000300774 CCTTTGCACCAAAGAGAGTTA pLKO_005 256 CDS 100% 4.950 3.465 N VPS29 n/a
13 TRCN0000379645 GAAAGTAGAACGAATCGAATA pLKO_005 655 CDS 100% 10.800 6.480 N VPS29 n/a
14 TRCN0000078594 CCATCATTTGTGTTGATGGAT pLKO.1 581 CDS 100% 0.300 0.180 N VPS29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719459.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03366 pDONR223 100% 98% 97.3% None 3_4insGCTGGGCAC;5_6delAGinsGA n/a
2 ccsbBroad304_03366 pLX_304 0% 98% 97.3% V5 3_4insGCTGGGCAC;5_6delAGinsGA n/a
3 TRCN0000481468 CTACGTAAACCGGCCGTCGTGACC pLX_317 79.4% 98% 97.3% V5 3_4insGCTGGGCAC;5_6delAGinsGA n/a
Download CSV