Transcript: Human XM_006719840.3

PREDICTED: Homo sapiens Nedd4 family interacting protein 2 (NDFIP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDFIP2 (54602)
Length:
5047
CDS:
483..1490

Additional Resources:

NCBI RefSeq record:
XM_006719840.3
NBCI Gene record:
NDFIP2 (54602)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365640 TTGGCCTTTCCTTGATCAAAT pLKO_005 1282 CDS 100% 13.200 18.480 N NDFIP2 n/a
2 TRCN0000151073 GCAGTTCTACACATGAAACAT pLKO.1 1936 3UTR 100% 5.625 7.875 N NDFIP2 n/a
3 TRCN0000154475 GCTGCTCATAGAACAAGGTAT pLKO.1 1455 CDS 100% 4.950 6.930 N NDFIP2 n/a
4 TRCN0000365568 TATTGGCTTTGGTGGATATTT pLKO_005 1356 CDS 100% 15.000 10.500 N NDFIP2 n/a
5 TRCN0000365567 TCCACCATATAGTAGTATTAC pLKO_005 923 CDS 100% 13.200 9.240 N NDFIP2 n/a
6 TRCN0000370775 ACTCAGAATCATCGGCTATAG pLKO_005 820 CDS 100% 10.800 7.560 N NDFIP2 n/a
7 TRCN0000370776 GCTACCTCTCTTCCTACATAC pLKO_005 1017 CDS 100% 10.800 7.560 N NDFIP2 n/a
8 TRCN0000157523 GAAGGCTAAAGCTGCTGCAAT pLKO.1 1049 CDS 100% 4.950 3.465 N NDFIP2 n/a
9 TRCN0000154510 GCAGTTAAGTCCAGTCACATT pLKO.1 1759 3UTR 100% 4.950 3.465 N NDFIP2 n/a
10 TRCN0000155558 CCTTCTGTATCACCAATACCA pLKO.1 1231 CDS 100% 3.000 2.100 N NDFIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12064 pDONR223 100% 71.7% 2.3% None 1_282del;317_318insGGT n/a
2 ccsbBroad304_12064 pLX_304 0% 71.7% 2.3% V5 (not translated due to prior stop codon) 1_282del;317_318insGGT n/a
Download CSV