Transcript: Human XM_006720398.3

PREDICTED: Homo sapiens family with sequence similarity 81 member A (FAM81A), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM81A (145773)
Length:
3653
CDS:
370..1476

Additional Resources:

NCBI RefSeq record:
XM_006720398.3
NBCI Gene record:
FAM81A (145773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144462 CCGTCAGAAGTATGATGTAAA pLKO.1 2453 3UTR 100% 13.200 18.480 N FAM81A n/a
2 TRCN0000121964 CCGTCTATGAAAGCATAGGAT pLKO.1 1361 CDS 100% 0.300 0.420 N FAM81A n/a
3 TRCN0000145069 CTATGGAACTAATTCTGCCTT pLKO.1 702 CDS 100% 2.640 2.112 N FAM81A n/a
4 TRCN0000144642 GCCATAGTGAAGCAACTTAAT pLKO.1 631 CDS 100% 13.200 9.240 N FAM81A n/a
5 TRCN0000144570 GAGGAGCATATCAGAAACATA pLKO.1 607 CDS 100% 5.625 3.938 N FAM81A n/a
6 TRCN0000121947 CCACCTAGATATTACAGGTTT pLKO.1 2150 3UTR 100% 4.950 3.465 N FAM81A n/a
7 TRCN0000139129 CGAATCACCAAGCTGGAGTTA pLKO.1 1285 CDS 100% 4.950 3.465 N FAM81A n/a
8 TRCN0000140186 GCAAGATGTGATGCCAGCATA pLKO.1 778 CDS 100% 4.950 3.465 N FAM81A n/a
9 TRCN0000139629 CGGGACAACATTAGCTATGGA pLKO.1 688 CDS 100% 3.000 2.100 N FAM81A n/a
10 TRCN0000181630 GCTATGGAACTAATTCTGCCT pLKO.1 701 CDS 100% 0.660 0.462 N Fam81a n/a
11 TRCN0000121971 CCACCATTTATGTAATGGAAA pLKO.1 2044 3UTR 100% 0.495 0.347 N FAM81A n/a
12 TRCN0000144483 CCCACCATTTATGTAATGGAA pLKO.1 2043 3UTR 100% 0.300 0.210 N FAM81A n/a
13 TRCN0000144019 CCAAACTTATCTTGGAAACGA pLKO.1 869 CDS 100% 3.000 1.800 N FAM81A n/a
14 TRCN0000144918 GCTTTCCTTGATTGTTAAGGA pLKO.1 1128 CDS 100% 0.300 0.180 N FAM81A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10479 pDONR223 100% 98.8% 98.9% None (many diffs) n/a
2 ccsbBroad304_10479 pLX_304 0% 98.8% 98.9% V5 (many diffs) n/a
3 TRCN0000477726 AACGTCGCCGTGAGGATTGATTAT pLX_317 37% 98.7% 65.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV