Construct: ORF TRCN0000477726
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014404.1_s317c1
- Derived from:
- ccsbBroadEn_10479
- DNA Barcode:
- AACGTCGCCGTGAGGATTGATTAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- FAM81A (145773)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477726
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 145773 | FAM81A | family with sequence simila... | NM_152450.3 | 98.7% | 65.7% | (many diffs) |
| 2 | human | 145773 | FAM81A | family with sequence simila... | XM_006720398.3 | 98.7% | 65.7% | (many diffs) |
| 3 | human | 145773 | FAM81A | family with sequence simila... | XM_011521249.2 | 98.7% | 65.7% | (many diffs) |
| 4 | human | 145773 | FAM81A | family with sequence simila... | XM_011521250.2 | 98.7% | 65.7% | (many diffs) |
| 5 | human | 145773 | FAM81A | family with sequence simila... | XM_024449846.1 | 98.7% | 65.7% | (many diffs) |
| 6 | human | 145773 | FAM81A | family with sequence simila... | XM_005254166.2 | 96.1% | 63.3% | (many diffs) |
| 7 | human | 145773 | FAM81A | family with sequence simila... | XM_011521247.2 | 96.1% | 63.3% | (many diffs) |
| 8 | human | 145773 | FAM81A | family with sequence simila... | XM_011521248.2 | 96.1% | 63.3% | (many diffs) |
| 9 | human | 145773 | FAM81A | family with sequence simila... | XM_017021931.1 | 96.1% | 63.3% | (many diffs) |
| 10 | human | 145773 | FAM81A | family with sequence simila... | XM_017021932.1 | 96.1% | 63.3% | (many diffs) |
| 11 | mouse | 76886 | Fam81a | family with sequence simila... | NM_029784.2 | 87.1% | 65.3% | (many diffs) |
| 12 | mouse | 76886 | Fam81a | family with sequence simila... | XM_006511550.3 | 87.1% | 65.3% | (many diffs) |
| 13 | mouse | 76886 | Fam81a | family with sequence simila... | XM_006511551.2 | 87.1% | 65.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 810
- ORF length:
- 744
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca tctaaggcga gttagaacca tgccccgaca cagccagtcc ctgacaatgg 121 caccatactc atctgtaagc ctcgtggagc agctggaaga caggatcctc tgccatgaga 181 aaaccaccgc cgccctcgta gagcacgcct ttcggattaa agatgacatt gtcaacagtt 241 tgcagaaaat gcaaaacaaa gggggaggtg accgcttggc caggcttttc ttggaggagc 301 atatcagaaa cataactgcc atagtgaagc aacttaatcg ggatatcgag gtactccagg 361 agcagattcg tgctcgggac aacattagct atggaactaa ttctgcctta aagaccctgg 421 agatgcgcca gctctccggt ttgggagatc ttcgaggaag agtggcaaga tgtgatgcca 481 gcatagctag actttctgca gagcacaaaa cgacctatga ggggctccag cacttgaaca 541 aagaacagca ggctgccaaa cttatcttgg aaacgaaaat caaagatgca gagggacaga 601 tttctcagct tttgaacaga gtggacttgt caatatcaga gcagagcacc aaactgaaga 661 tgtctcacag agacagtaac caccagcttc agcttttgga cactaaattt aaaggtacag 721 ttgaggaact cagtaaccag atattatctg cacggagttG GTTGCAACAG GAACAAGAAC 781 GGATAGAAAA AAGAGCTTTT ACAGAAAATT GATCAGCTTT CCTTGATTGT TAAGGAAAAC 841 AGTGGAGCCA GTGAAAGGGA TATGGAGAAG AAGCTCAGCC AGATGTCAGC CAGGCTTGAC 901 AAAATAGAAG AGGGTCAAAA GAAGACTTTT GATGGTCAGA GAACAAGGCA AGAAGAGGAG 961 AAGATGCACG GGCGAATCAC CAAGCTGGAG TTACAGATGA ACCAGAACAT CAAGGAAATG 1021 AAAGCAGAAG TTAATGCTGG GTTTACAGCC GTCTATGAAA GCATAGGATC CATCAGGCAA 1081 GTTCTCGAGG CCAAGATGAA GCTGGACAGG GACCAGCTAC AGAAGCAAAT CCAGCTGATG 1141 CAGAAGCCAG AGACCCCCAT GTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG 1201 CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT 1261 GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAAAC GTCGCCGTGA 1321 GGATTGATTA TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat 1381 t