Transcript: Human XM_006720592.3

PREDICTED: Homo sapiens poly(ADP-ribose) polymerase family member 16 (PARP16), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARP16 (54956)
Length:
2553
CDS:
331..1245

Additional Resources:

NCBI RefSeq record:
XM_006720592.3
NBCI Gene record:
PARP16 (54956)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720592.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422730 ACGAGCGAGAATCAAACATAG pLKO_005 987 CDS 100% 10.800 15.120 N PARP16 n/a
2 TRCN0000053171 CCATTGGTTTACCGTCATGAT pLKO.1 1140 CDS 100% 4.950 6.930 N PARP16 n/a
3 TRCN0000440894 GACCCAGCCAACGCCAAATTT pLKO_005 667 CDS 100% 15.000 10.500 N PARP16 n/a
4 TRCN0000336409 GAGAACGAGACCTAATCTATG pLKO_005 701 CDS 100% 10.800 7.560 N Parp16 n/a
5 TRCN0000053170 CCAAAGGAGAACGAGACCTAA pLKO.1 695 CDS 100% 4.950 3.465 N PARP16 n/a
6 TRCN0000053169 CCTCCTGGTGTATTCACAGAA pLKO.1 1074 CDS 100% 4.950 3.465 N PARP16 n/a
7 TRCN0000053172 CCTGTTTGAAATTGAGTACTT pLKO.1 645 CDS 100% 4.950 3.465 N PARP16 n/a
8 TRCN0000053168 GCTGCTCATAGTGAGTGTCAT pLKO.1 1179 CDS 100% 4.950 3.465 N PARP16 n/a
9 TRCN0000433598 TGTACCTCCTATGCCTCATGT pLKO_005 1303 3UTR 100% 4.950 3.465 N PARP16 n/a
10 TRCN0000336341 ACTTGAGCCTGGCCCTCATTT pLKO_005 830 CDS 100% 13.200 18.480 N Parp16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720592.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03496 pDONR223 100% 94.1% 94.1% None 254_255ins57 n/a
2 ccsbBroad304_03496 pLX_304 0% 94.1% 94.1% V5 254_255ins57 n/a
3 TRCN0000471995 GTGACGTGGTTTACTCTACAAATT pLX_317 35.6% 94.1% 94.1% V5 254_255ins57 n/a
4 ccsbBroadEn_12121 pDONR223 100% 93.6% 93.4% None (many diffs) n/a
5 ccsbBroad304_12121 pLX_304 0% 93.6% 93.4% V5 (many diffs) n/a
6 TRCN0000467473 TGCCGCCCGGAACTAGAAACGCGG pLX_317 27.1% 93.6% 93.4% V5 (many diffs) n/a
Download CSV