Transcript: Human XM_006720725.3

PREDICTED: Homo sapiens synaptosome associated protein 23 (SNAP23), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNAP23 (8773)
Length:
2671
CDS:
423..1091

Additional Resources:

NCBI RefSeq record:
XM_006720725.3
NBCI Gene record:
SNAP23 (8773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720725.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218715 GAAACTCATTGACAGCTAAAG pLKO_005 1073 CDS 100% 10.800 15.120 N SNAP23 n/a
2 TRCN0000145326 GAACAACTAAACCGCATAGAA pLKO.1 570 CDS 100% 5.625 7.875 N SNAP23 n/a
3 TRCN0000141483 CCTCATATACTTCAGCAGGTT pLKO.1 1354 3UTR 100% 2.640 3.696 N SNAP23 n/a
4 TRCN0000142667 CGCATAACTAATGATGCCAGA pLKO.1 879 CDS 100% 2.160 3.024 N SNAP23 n/a
5 TRCN0000144931 GCTCTTCTAATTGGGAGATAA pLKO.1 1183 3UTR 100% 13.200 10.560 N SNAP23 n/a
6 TRCN0000141093 CCTGAACATAGGCAATGAGAT pLKO.1 965 CDS 100% 4.950 3.960 N SNAP23 n/a
7 TRCN0000219097 CAGTATCCTGGGAAATCTAAA pLKO_005 935 CDS 100% 13.200 9.240 N SNAP23 n/a
8 TRCN0000229795 GAGTCTGGCAAGGCTTATAAG pLKO_005 735 CDS 100% 13.200 9.240 N SNAP23 n/a
9 TRCN0000257197 TTGCAGTTATAGCCAATTTAG pLKO_005 1586 3UTR 100% 13.200 9.240 N SNAP23 n/a
10 TRCN0000218039 GTGGATACATTAAACGCATAA pLKO_005 865 CDS 100% 10.800 7.560 N SNAP23 n/a
11 TRCN0000145577 CACCTTGCAATGTAGTATCTA pLKO.1 784 CDS 100% 5.625 3.938 N SNAP23 n/a
12 TRCN0000143926 CCCATTTCTTATTGCACCATT pLKO.1 2065 3UTR 100% 4.950 3.465 N SNAP23 n/a
13 TRCN0000143958 CTGAACATAGGCAATGAGATT pLKO.1 966 CDS 100% 4.950 3.465 N SNAP23 n/a
14 TRCN0000144788 GCAAGGCTTATAAGACAACAT pLKO.1 742 CDS 100% 4.950 3.465 N SNAP23 n/a
15 TRCN0000144789 GCAATGAGATTGATGCTCAAA pLKO.1 976 CDS 100% 4.950 3.465 N SNAP23 n/a
16 TRCN0000142094 GCCAGAGCAAAGAAACTCATT pLKO.1 1062 CDS 100% 4.950 3.465 N SNAP23 n/a
17 TRCN0000141271 CTCACCAGATTACTGATGAGT pLKO.1 460 CDS 100% 3.000 2.100 N SNAP23 n/a
18 TRCN0000139864 GCCATGAAGAAGGAAGCTGTA pLKO.1 1412 3UTR 100% 4.050 2.430 N SNAP23 n/a
19 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 1952 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
20 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1888 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720725.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02013 pDONR223 100% 95% 95% None 265_297del n/a
2 ccsbBroad304_02013 pLX_304 0% 95% 95% V5 265_297del n/a
3 TRCN0000470641 TGTAATGATATTTGACCGAATGTC pLX_317 55.8% 95% 95% V5 (not translated due to frame shift) 265_297del n/a
Download CSV