Transcript: Human XM_006721942.3

PREDICTED: Homo sapiens phosphodiesterase 6G (PDE6G), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE6G (5148)
Length:
1996
CDS:
968..1381

Additional Resources:

NCBI RefSeq record:
XM_006721942.3
NBCI Gene record:
PDE6G (5148)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440992 AGAAAGGCGTTCAAGGGTTTG pLKO_005 1248 CDS 100% 6.000 8.400 N PDE6G n/a
2 TRCN0000048855 CCCTAAATTTAAGCAGCGACA pLKO.1 1198 CDS 100% 2.160 3.024 N PDE6G n/a
3 TRCN0000174080 CCCTAAATTTAAGCAGCGACA pLKO.1 1198 CDS 100% 2.160 3.024 N PDE6G n/a
4 TRCN0000048856 GCGACAGACCAGGCAGTTCAA pLKO.1 1213 CDS 100% 1.650 1.320 N PDE6G n/a
5 TRCN0000048853 CCTGCTCAACATCTGGAGATA pLKO.1 1595 3UTR 100% 4.950 3.465 N PDE6G n/a
6 TRCN0000048857 GAACAGACATCACAGTCATCT pLKO.1 1299 CDS 100% 4.950 3.465 N PDE6G n/a
7 TRCN0000048854 GCTGGCCCAATATGGCATCAT pLKO.1 1357 CDS 100% 4.950 3.465 N PDE6G n/a
8 TRCN0000441333 GTGCCCTTAGTTTGGACATGC pLKO_005 1844 3UTR 100% 4.050 2.835 N PDE6G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01159 pDONR223 100% 63.5% 63.5% None 1_150del n/a
2 ccsbBroad304_01159 pLX_304 0% 63.5% 63.5% V5 1_150del n/a
3 TRCN0000467265 AACTCATGCTGGTCAACCACTTAT pLX_317 100% 63.5% 63.5% V5 1_150del n/a
Download CSV