Transcript: Human XM_006722492.4

PREDICTED: Homo sapiens dymeclin (DYM), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DYM (54808)
Length:
5305
CDS:
358..1875

Additional Resources:

NCBI RefSeq record:
XM_006722492.4
NBCI Gene record:
DYM (54808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154130 CCATGTGTATATGGCCCTTAT pLKO.1 1533 CDS 100% 10.800 15.120 N DYM n/a
2 TRCN0000151782 CATGTGTATATGGCCCTTATA pLKO.1 1534 CDS 100% 13.200 10.560 N DYM n/a
3 TRCN0000432400 GTTTGGCAGCTTTAGCAAATA pLKO_005 1745 CDS 100% 13.200 9.240 N DYM n/a
4 TRCN0000429540 TATTCCACTCTTAGATATTAC pLKO_005 840 CDS 100% 13.200 9.240 N DYM n/a
5 TRCN0000424342 TGGAATCAGCTTCTCTCATTT pLKO_005 454 CDS 100% 13.200 9.240 N DYM n/a
6 TRCN0000152800 GCAGACACACAATGCTTTGTT pLKO.1 660 CDS 100% 5.625 3.938 N DYM n/a
7 TRCN0000151304 GCACTAATTAAGGTCTTCCTT pLKO.1 583 CDS 100% 3.000 2.100 N DYM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08410 pDONR223 100% 74.5% 72.9% None (many diffs) n/a
2 ccsbBroad304_08410 pLX_304 0% 74.5% 72.9% V5 (many diffs) n/a
3 TRCN0000475275 GAATCTTAACCAGAACTAATTATC pLX_317 23% 74.5% 72.9% V5 (many diffs) n/a
Download CSV