Transcript: Human XM_006722573.2

PREDICTED: Homo sapiens protein inhibitor of activated STAT 2 (PIAS2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIAS2 (9063)
Length:
4547
CDS:
54..1889

Additional Resources:

NCBI RefSeq record:
XM_006722573.2
NBCI Gene record:
PIAS2 (9063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230129 CATTCCACCATACGCCAATAT pLKO_005 1774 CDS 100% 13.200 18.480 N PIAS2 n/a
2 TRCN0000013352 CGAGTTTAGTTCAAAGCAGTA pLKO.1 661 CDS 100% 4.050 5.670 N PIAS2 n/a
3 TRCN0000013349 CCACAATCAAATCATCGGTTT pLKO.1 397 CDS 100% 4.050 3.240 N PIAS2 n/a
4 TRCN0000230128 ATCATTCCAGAGCACTAATTA pLKO_005 1120 CDS 100% 15.000 10.500 N PIAS2 n/a
5 TRCN0000428983 ATCATTCCAGAGCACTAATTA pLKO_005 1120 CDS 100% 15.000 10.500 N Pias2 n/a
6 TRCN0000422690 CTTACATCAGCCATGTTATTA pLKO_005 1065 CDS 100% 15.000 10.500 N Pias2 n/a
7 TRCN0000230127 GGCTTTGCTGGACGGAATAAA pLKO_005 240 CDS 100% 15.000 10.500 N PIAS2 n/a
8 TRCN0000431539 CTCATCAAGCCCACGAGTTTA pLKO_005 648 CDS 100% 13.200 9.240 N Pias2 n/a
9 TRCN0000013348 GCCATGTTATTACAGAGATTA pLKO.1 1074 CDS 100% 13.200 9.240 N PIAS2 n/a
10 TRCN0000013351 GCTGCTATTCCGCCTTCATTA pLKO.1 1737 CDS 100% 13.200 9.240 N PIAS2 n/a
11 TRCN0000435253 GCCCTCAAGAAGATAACTATC pLKO_005 829 CDS 100% 10.800 7.560 N Pias2 n/a
12 TRCN0000013350 GCAAGCAAGAAGAAAGTAGAT pLKO.1 1554 CDS 100% 4.950 3.465 N PIAS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07353 pDONR223 100% 93.3% 91.8% None (many diffs) n/a
2 ccsbBroad304_07353 pLX_304 0% 93.3% 91.8% V5 (many diffs) n/a
3 TRCN0000477220 TCTAACTGATGACGTACAGTGCGC pLX_317 23.2% 93.3% 91.8% V5 (many diffs) n/a
Download CSV