Construct: ORF TRCN0000477220
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000749.1_s317c1
- Derived from:
- ccsbBroadEn_07353
- DNA Barcode:
- TCTAACTGATGACGTACAGTGCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIAS2 (9063)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477220
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_173206.4 | 99.9% | 99.8% | 18G>T |
2 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324051.2 | 98.4% | 98.4% | 0_1ins27 |
3 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324052.2 | 98.4% | 98.4% | 0_1ins27 |
4 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324053.2 | 98.4% | 98.4% | 0_1ins27 |
5 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324054.2 | 98.4% | 98.4% | 0_1ins27 |
6 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001354033.2 | 98.4% | 98.4% | 0_1ins27 |
7 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_017026072.1 | 98.4% | 98.4% | 0_1ins27 |
8 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_006722573.2 | 93.3% | 91.8% | (many diffs) |
9 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324046.2 | 92.4% | 93.7% | (many diffs) |
10 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001354034.2 | 90.8% | 88.7% | (many diffs) |
11 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_005258377.3 | 89.7% | 87.2% | (many diffs) |
12 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_011526258.2 | 89.5% | 87.9% | (many diffs) |
13 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324047.2 | 89.4% | 87.4% | (many diffs) |
14 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001354038.2 | 89.4% | 87.4% | (many diffs) |
15 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001354039.2 | 89.4% | 87.4% | (many diffs) |
16 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_024451285.1 | 89.2% | 88.1% | (many diffs) |
17 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_004671.5 | 88.3% | 88.8% | (many diffs) |
18 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324058.2 | 88.2% | 87.7% | (many diffs) |
19 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_024451286.1 | 87.7% | 86.7% | (many diffs) |
20 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324048.2 | 86.9% | 87.6% | (many diffs) |
21 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324049.2 | 86.9% | 87.6% | (many diffs) |
22 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001354035.2 | 86.9% | 87.6% | (many diffs) |
23 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001354036.2 | 86.9% | 87.6% | (many diffs) |
24 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_024451282.1 | 86.9% | 87.6% | (many diffs) |
25 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324055.2 | 86.7% | 86.3% | (many diffs) |
26 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324057.2 | 86.7% | 86.3% | (many diffs) |
27 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324059.2 | 86.7% | 86.3% | (many diffs) |
28 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001354037.2 | 86.7% | 86.3% | (many diffs) |
29 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_006722571.3 | 85.3% | 82.1% | (many diffs) |
30 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_024451283.1 | 83.3% | 80.9% | (many diffs) |
31 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_024451284.1 | 83.3% | 80.9% | (many diffs) |
32 | human | 9063 | PIAS2 | protein inhibitor of activa... | XM_006722572.3 | 83% | 82.2% | (many diffs) |
33 | human | 9063 | PIAS2 | protein inhibitor of activa... | NM_001324060.2 | 69% | 68.4% | (many diffs) |
34 | human | 9063 | PIAS2 | protein inhibitor of activa... | XR_001753300.1 | 59% | (many diffs) | |
35 | human | 9063 | PIAS2 | protein inhibitor of activa... | XR_001753298.1 | 57.6% | (many diffs) | |
36 | human | 9063 | PIAS2 | protein inhibitor of activa... | NR_148699.2 | 35.8% | (many diffs) | |
37 | human | 9063 | PIAS2 | protein inhibitor of activa... | NR_136685.2 | 30.7% | (many diffs) | |
38 | human | 9063 | PIAS2 | protein inhibitor of activa... | NR_148700.2 | 15% | 1_162del;180G>T;1879_11413del | |
39 | human | 9063 | PIAS2 | protein inhibitor of activa... | NR_148701.2 | 14.8% | (many diffs) | |
40 | human | 9063 | PIAS2 | protein inhibitor of activa... | NR_148703.2 | 14.7% | (many diffs) | |
41 | human | 9063 | PIAS2 | protein inhibitor of activa... | NR_136684.2 | 14.3% | (many diffs) | |
42 | human | 9063 | PIAS2 | protein inhibitor of activa... | NR_148702.2 | 14.3% | (many diffs) | |
43 | mouse | 17344 | Pias2 | protein inhibitor of activa... | NM_001164169.1 | 93% | 97.5% | (many diffs) |
44 | mouse | 17344 | Pias2 | protein inhibitor of activa... | NM_001164170.1 | 91.8% | 96.3% | (many diffs) |
45 | mouse | 17344 | Pias2 | protein inhibitor of activa... | NM_001164167.1 | 87.4% | 93.4% | (many diffs) |
46 | mouse | 17344 | Pias2 | protein inhibitor of activa... | XM_006526423.2 | 84.7% | 87.1% | (many diffs) |
47 | mouse | 17344 | Pias2 | protein inhibitor of activa... | XM_006526425.2 | 83.6% | 86% | (many diffs) |
48 | mouse | 17344 | Pias2 | protein inhibitor of activa... | NM_008602.4 | 82.3% | 87.2% | (many diffs) |
49 | mouse | 17344 | Pias2 | protein inhibitor of activa... | NM_001164168.1 | 81.2% | 86.1% | (many diffs) |
50 | mouse | 17344 | Pias2 | protein inhibitor of activa... | XR_001782348.1 | 19.1% | (many diffs) | |
51 | mouse | 17344 | Pias2 | protein inhibitor of activa... | XR_001782349.1 | 19% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1782
- ORF length:
- 1716
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggatttcgaa gatttgagga atatggtttc tagttttagg gtttctgaac 121 tacaagtatt actaggcttt gctggacgga ataaaagtgg acgcaagcat gacctcctga 181 tgagggcgct gcatttattg aagagcggct gcagccctgc ggttcagatt aaaatccgag 241 aattgtatag acgccgatat ccacgaactc ttgaaggact ttctgattta tccacaatca 301 aatcatcggt tttcagtttg gatggtggct catcacctgt agaacctgac ttggccgtgg 361 ctggaatcca ctcgttgcct tccacttcag ttacacctca ctcaccatcc tctcctgttg 421 gttctgtgct gcttcaagat actaagccca catttgagat gcagcagcca tctcccccaa 481 ttcctcctgt ccatcctgat gtgcagttaa aaaatctgcc cttttatgat gtccttgatg 541 ttctcatcaa gcccacgagt ttagttcaaa gcagtattca gcgatttcaa gagaagtttt 601 ttatttttgc tttgacacct caacaagtta gagagatatg catatccagg gattttttgc 661 caggtggtag gagagattat acagtccaag ttcagttgag actttgcctg gcagagacaa 721 gttgccctca agaagataac tatccaaata gtctatgtat aaaagtaaat gggaagctat 781 ttcctttgcc tggctatgca ccaccgccta aaaatgggat tgaacagaag cgccctggac 841 gccccttgaa tattacatct ttagttaggt tatcttcagc tgtgccaaac caaatttcca 901 tttcttgggc atcagaaatt gggaagaatt actctatgtc tgtatatctt gtacggcagc 961 ttacatcagc catgttatta cagagattaa aaatgaaagg tattagaaac cctgatcatt 1021 ccagagcact aattaaagaa aaacttactg cagatcctga tagtgaaatt gctacaacta 1081 gccttcgggt atccttgatg tgccctttag gaaaaatgag gctgacaatc ccatgccgtg 1141 cagtgacttg tacacatctg cagtgttttg atgctgccct ctatctacaa atgaatgaga 1201 aaaagcccac ctggatttgt cctgtgtgtg acaaaaaagc tgcctatgaa agtctaatat 1261 tagatgggct ttttatggaa attctcaatg actgttctga tgtagatgag atcaaattcc 1321 aagaagatgg ttcttggtgt ccaatgagac cgaagaaaga agctatgaaa gtatccagcc 1381 aaccgtgtaC AAAAATAGAA AGTTCAAGCG TCCTCAGTAA GCCTTGTTCA GTGACTGTAG 1441 CCAGTGAGGC AAGCAAGAAG AAAGTAGATG TTATTGATCT TACAATAGAA AGCTCTTCTG 1501 ACGAAGAGGA AGACCCTCCT GCCAAAAGGA AATGCATCTT TATGTCAGAA ACACAAAGCA 1561 GCCCAACCAA AGGGGTTCTC ATGTATCAGC CATCTTCTGT AAGGGTGCCC AGTGTGACTT 1621 CGGTTGATCC TGCTGCTATT CCGCCTTCAT TAACAGACTA CTCAGTACCA TTCCACCATA 1681 CGCCAATATC AAGCATGTCA TCAGATTTGC CAGGAGAACA AAGAAGAAAT GATATTAATA 1741 ATGAACTGAA GCTTGGAACA TCTTCTGATA CTGTGCAACA GTGCCCAACT TTCTTGTACA 1801 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1861 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1921 AGGACGATCT AACTGATGAC GTACAGTGCG CACGCGTTAA GTCgacaatc aacctctgga 1981 ttacaaaatt tgtgaaagat t