Transcript: Human XM_006722951.3

PREDICTED: Homo sapiens amyloid beta precursor protein binding family A member 3 (APBA3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APBA3 (9546)
Length:
1866
CDS:
611..1837

Additional Resources:

NCBI RefSeq record:
XM_006722951.3
NBCI Gene record:
APBA3 (9546)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165288 GTCGGATGGAACTTGATGAGT pLKO.1 67 5UTR 100% 3.000 4.200 N APBA3 n/a
2 TRCN0000203309 GTCCTGTATGATTTCCTAATA pLKO.1 1814 CDS 100% 13.200 10.560 N APBA3 n/a
3 TRCN0000164702 CTATGGCGAGGTGCATATCAA pLKO.1 1635 CDS 100% 5.625 4.500 N APBA3 n/a
4 TRCN0000204269 CAAGATGCTCTGCCACGTATT pLKO.1 862 CDS 100% 10.800 7.560 N APBA3 n/a
5 TRCN0000204319 CCACTTCTCCAACAGTGACAA pLKO.1 1036 CDS 100% 4.950 3.465 N APBA3 n/a
6 TRCN0000164664 CACCAAGAGGATCAAGGTCTT pLKO.1 697 CDS 100% 4.050 2.835 N APBA3 n/a
7 TRCN0000164743 CCAAGAGGATCAAGGTCTTGA pLKO.1 699 CDS 100% 0.495 0.347 N APBA3 n/a
8 TRCN0000188496 CTCAGTCGGATGGAACTTGAT pLKO.1 63 5UTR 100% 4.950 2.970 N APBA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11387 pDONR223 100% 81.4% 59.9% None (many diffs) n/a
2 ccsbBroad304_11387 pLX_304 0% 81.4% 59.9% V5 (many diffs) n/a
3 TRCN0000473384 TGTCGGAGACAGTTAAATCCTGAT pLX_317 43.7% 81.4% 59.9% V5 (many diffs) n/a
4 ccsbBroadEn_02193 pDONR223 100% 51.2% 39.1% None 0_1ins726;790_893del;1104_1224del n/a
5 ccsbBroad304_02193 pLX_304 0% 51.2% 39.1% V5 0_1ins726;790_893del;1104_1224del n/a
Download CSV