Transcript: Human XM_006723412.2

PREDICTED: Homo sapiens ankyrin repeat domain 27 (ANKRD27), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD27 (84079)
Length:
4342
CDS:
50..3202

Additional Resources:

NCBI RefSeq record:
XM_006723412.2
NBCI Gene record:
ANKRD27 (84079)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338570 ATTCAAGGGAACAGGATTAAA pLKO_005 272 CDS 100% 15.000 21.000 N ANKRD27 n/a
2 TRCN0000338569 ATTCCTCCACCTAGGATTAAG pLKO_005 3597 3UTR 100% 13.200 18.480 N ANKRD27 n/a
3 TRCN0000148401 GCATCAGGTAACCAGAAAGAA pLKO.1 1265 CDS 100% 5.625 4.500 N ANKRD27 n/a
4 TRCN0000148842 CCAAGCTGTGTTGCTTCATTA pLKO.1 2738 CDS 100% 13.200 9.240 N ANKRD27 n/a
5 TRCN0000147415 GCTGGAGAGAAGTAAGTAATT pLKO.1 3617 3UTR 100% 13.200 9.240 N ANKRD27 n/a
6 TRCN0000338642 CCATCGAACATTCCGAGAATG pLKO_005 526 CDS 100% 10.800 7.560 N ANKRD27 n/a
7 TRCN0000148894 CCGGAGTTCAGCTTTAACATA pLKO.1 821 CDS 100% 5.625 3.938 N ANKRD27 n/a
8 TRCN0000338639 CCGGAGTTCAGCTTTAACATA pLKO_005 821 CDS 100% 5.625 3.938 N ANKRD27 n/a
9 TRCN0000128723 CCAGTCTACTTGTCAGTTTGA pLKO.1 190 CDS 100% 4.950 3.465 N ANKRD27 n/a
10 TRCN0000148909 CGTGAACACATCTGAGAACTA pLKO.1 3265 3UTR 100% 4.950 3.465 N ANKRD27 n/a
11 TRCN0000149708 GCAAGGATGCAACAAGATGAT pLKO.1 3238 3UTR 100% 4.950 3.465 N ANKRD27 n/a
12 TRCN0000148965 GATCCCTAATTGGATGGCAAA pLKO.1 1021 CDS 100% 4.050 2.835 N ANKRD27 n/a
13 TRCN0000338640 GATCCCTAATTGGATGGCAAA pLKO_005 1021 CDS 100% 4.050 2.835 N ANKRD27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04327 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04327 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472417 CCCCGGTGAGCGGCCGACGTAAAT pLX_317 14.4% 100% 100% V5 n/a
Download CSV