Transcript: Human XM_006723592.3

PREDICTED: Homo sapiens NSFL1 cofactor (NSFL1C), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NSFL1C (55968)
Length:
3576
CDS:
1208..1993

Additional Resources:

NCBI RefSeq record:
XM_006723592.3
NBCI Gene record:
NSFL1C (55968)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723592.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377534 ATCGTGCAGCGGTTAACATAA pLKO_005 1973 CDS 100% 13.200 18.480 N NSFL1C n/a
2 TRCN0000160212 CCCTATAAGTTTGATTGCTAT pLKO.1 3124 3UTR 100% 4.950 6.930 N NSFL1C n/a
3 TRCN0000158422 CCAGTGATAATAGAGTGACAT pLKO.1 1169 5UTR 100% 4.950 6.435 N NSFL1C n/a
4 TRCN0000322808 CCACTTGTTCCCACGAGAATA pLKO_005 2456 3UTR 100% 13.200 9.240 N NSFL1C n/a
5 TRCN0000163558 GAGTGGATTCAGCCTGGATAA pLKO.1 1444 CDS 100% 10.800 7.560 N NSFL1C n/a
6 TRCN0000322807 GAGTGGATTCAGCCTGGATAA pLKO_005 1444 CDS 100% 10.800 7.560 N NSFL1C n/a
7 TRCN0000030465 AGCTACCAAGACCCATCCAAT pLKO.1 1478 CDS 100% 4.950 3.465 N Nsfl1c n/a
8 TRCN0000279306 AGCTACCAAGACCCATCCAAT pLKO_005 1478 CDS 100% 4.950 3.465 N Nsfl1c n/a
9 TRCN0000030468 CCAGAGGAAGAGTCTGCCTAT pLKO.1 1361 CDS 100% 4.050 2.835 N Nsfl1c n/a
10 TRCN0000297657 CCAGAGGAAGAGTCTGCCTAT pLKO_005 1361 CDS 100% 4.050 2.835 N Nsfl1c n/a
11 TRCN0000164655 GAGGACTTTGTGAAGCCCAAA pLKO.1 1601 CDS 100% 4.050 2.430 N NSFL1C n/a
12 TRCN0000350655 GAGGACTTTGTGAAGCCCAAA pLKO_005 1601 CDS 100% 4.050 2.430 N NSFL1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723592.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03687 pDONR223 100% 70.5% 64.6% None 0_1ins238;41_42ins31;44_45ins58 n/a
2 ccsbBroad304_03687 pLX_304 0% 70.5% 64.6% V5 0_1ins238;41_42ins31;44_45ins58 n/a
3 TRCN0000480798 GCCCGCGGTGGGCAGTGATTACAG pLX_317 39.2% 70.5% 64.6% V5 0_1ins238;41_42ins31;44_45ins58 n/a
Download CSV