Transcript: Human XM_006723769.3

PREDICTED: Homo sapiens pre-mRNA processing factor 6 (PRPF6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRPF6 (24148)
Length:
2819
CDS:
106..2712

Additional Resources:

NCBI RefSeq record:
XM_006723769.3
NBCI Gene record:
PRPF6 (24148)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298539 ACCCTATCCAGGTGGACTAAA pLKO_005 741 CDS 100% 13.200 18.480 N PRPF6 n/a
2 TRCN0000298540 CAAGTAGCTCGGAACCTTATC pLKO_005 1081 CDS 100% 10.800 15.120 N PRPF6 n/a
3 TRCN0000074634 GCGTACTTCGAGAAGAACCAT pLKO.1 1627 CDS 100% 3.000 4.200 N PRPF6 n/a
4 TRCN0000286271 GCGTACTTCGAGAAGAACCAT pLKO_005 1627 CDS 100% 3.000 4.200 N PRPF6 n/a
5 TRCN0000074633 CGAGGATCTAAATGACACCAA pLKO.1 315 CDS 100% 2.640 2.112 N PRPF6 n/a
6 TRCN0000286270 CGAGGATCTAAATGACACCAA pLKO_005 315 CDS 100% 2.640 2.112 N PRPF6 n/a
7 TRCN0000074635 AGGATCTAAATGACACCAATT pLKO.1 317 CDS 100% 10.800 7.560 N PRPF6 n/a
8 TRCN0000074636 AGGAGAAGATTGGGCAGCTTA pLKO.1 2144 CDS 100% 4.950 3.465 N PRPF6 n/a
9 TRCN0000074637 GACGGATTTAAATTCCATGAT pLKO.1 927 CDS 100% 4.950 3.465 N PRPF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02845 pDONR223 100% 92.2% 92.2% None 1303_1304ins219 n/a
2 ccsbBroad304_02845 pLX_304 0% 92.2% 92.2% V5 1303_1304ins219 n/a
3 TRCN0000477629 CACGATGATTCGACTCGATGGTAA pLX_317 11.7% 92.2% 92.2% V5 1303_1304ins219 n/a
Download CSV