Transcript: Human XM_006724151.2

PREDICTED: Homo sapiens ENTH domain containing 1 (ENTHD1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENTHD1 (150350)
Length:
2203
CDS:
84..1568

Additional Resources:

NCBI RefSeq record:
XM_006724151.2
NBCI Gene record:
ENTHD1 (150350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153695 CCCAAGACTTACGTTAGCATT pLKO.1 1614 3UTR 100% 4.950 6.930 N ENTHD1 n/a
2 TRCN0000151980 CGCTAGATTACATGAAGATCT pLKO.1 1421 CDS 100% 4.950 6.930 N ENTHD1 n/a
3 TRCN0000152541 GCCAAGATGTTCATTTGCCTA pLKO.1 373 CDS 100% 2.640 3.696 N ENTHD1 n/a
4 TRCN0000434951 AGAGATCAGATGGTATCTTTA pLKO_005 637 CDS 100% 13.200 9.240 N ENTHD1 n/a
5 TRCN0000413612 GAGCTCAGATCAGATCTAATC pLKO_005 1550 CDS 100% 10.800 7.560 N ENTHD1 n/a
6 TRCN0000150529 GCTCATCTCTTATCACCAATT pLKO.1 1044 CDS 100% 10.800 7.560 N ENTHD1 n/a
7 TRCN0000151362 GATGTTCATTTGCCTACAGAA pLKO.1 378 CDS 100% 4.950 3.465 N ENTHD1 n/a
8 TRCN0000153162 GCAGGATTGAAACAAGAGCAT pLKO.1 351 CDS 100% 2.640 1.848 N ENTHD1 n/a
9 TRCN0000157501 GCTCTGTACCTCAAATGGGTT pLKO.1 1827 3UTR 100% 2.640 1.584 N ENTHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05039 pDONR223 100% 81.2% 80.7% None (many diffs) n/a
2 ccsbBroad304_05039 pLX_304 0% 81.2% 80.7% V5 (many diffs) n/a
3 TRCN0000491628 CGCCGTTGGGCCCGGATCCAACCA pLX_317 21.3% 81.2% 80.7% V5 (many diffs) n/a
Download CSV