Transcript: Human XM_006724239.2

PREDICTED: Homo sapiens zinc finger DHHC-type containing 8 (ZDHHC8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC8 (29801)
Length:
2807
CDS:
96..2432

Additional Resources:

NCBI RefSeq record:
XM_006724239.2
NBCI Gene record:
ZDHHC8 (29801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163732 GTTTGAAGCCGCCTTTCCTTA pLKO.1 886 CDS 100% 4.950 6.930 N ZDHHC8 n/a
2 TRCN0000162216 CAAGGTCAAGCTTAGTGACAA pLKO.1 938 CDS 100% 4.950 3.465 N ZDHHC8 n/a
3 TRCN0000162999 GCTGTACAAGAACGTGGATGT pLKO.1 362 CDS 100% 4.050 2.835 N ZDHHC8 n/a
4 TRCN0000162423 CACCTGCCATGTACAAGTTTA pLKO.1 1147 CDS 100% 13.200 7.920 N ZDHHC8 n/a
5 TRCN0000161745 CAATGGCATCATCTTCCTCTT pLKO.1 245 CDS 100% 4.050 2.430 N ZDHHC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13261 pDONR223 100% 13% 12.2% None (many diffs) n/a
2 ccsbBroad304_13261 pLX_304 0% 13% 12.2% V5 (many diffs) n/a
3 TRCN0000491604 GCGTCTCGTGCTCTTGGCTTGCGG pLX_317 98.3% 13% 12.2% V5 (many diffs) n/a
Download CSV