Transcript: Human XM_006724260.4

PREDICTED: Homo sapiens eukaryotic translation initiation factor 3 subunit L (EIF3L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EIF3L (51386)
Length:
2363
CDS:
454..2196

Additional Resources:

NCBI RefSeq record:
XM_006724260.4
NBCI Gene record:
EIF3L (51386)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724260.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074844 GCAGAGGTTTGAATCCTATTA pLKO.1 1035 CDS 100% 13.200 10.560 N EIF3L n/a
2 TRCN0000307934 GCAGAGGTTTGAATCCTATTA pLKO_005 1035 CDS 100% 13.200 10.560 N EIF3L n/a
3 TRCN0000074846 CCTGGTAGACAAATCCAACAT pLKO.1 1281 CDS 100% 4.950 3.465 N EIF3L n/a
4 TRCN0000307937 CCTGGTAGACAAATCCAACAT pLKO_005 1281 CDS 100% 4.950 3.465 N EIF3L n/a
5 TRCN0000074845 CCTTGCTTATGAACGTCAGTA pLKO.1 681 CDS 100% 4.950 3.465 N EIF3L n/a
6 TRCN0000292011 CCTTGCTTATGAACGTCAGTA pLKO_005 681 CDS 100% 4.950 3.465 N EIF3L n/a
7 TRCN0000074847 CTGGGATATTATCGATGAGTT pLKO.1 1131 CDS 100% 4.950 3.465 N EIF3L n/a
8 TRCN0000292010 CTGGGATATTATCGATGAGTT pLKO_005 1131 CDS 100% 4.950 3.465 N EIF3L n/a
9 TRCN0000074843 ACACACATTCAGGAACCTGTT pLKO.1 2205 3UTR 100% 4.050 2.835 N EIF3L n/a
10 TRCN0000292009 ACACACATTCAGGAACCTGTT pLKO_005 2205 3UTR 100% 4.050 2.835 N EIF3L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724260.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03296 pDONR223 100% 88.4% 88.4% None 1_129del;1702_1703ins81 n/a
2 ccsbBroad304_03296 pLX_304 0% 88.4% 88.4% V5 1_129del;1702_1703ins81 n/a
3 TRCN0000469269 AATGCGTGTTAACGGGATACGATT pLX_317 21% 88.4% 88.4% V5 1_129del;1702_1703ins81 n/a
4 ccsbBroadEn_15838 pDONR223 0% 88.4% 88.4% None 1_129del;1275T>C;1702_1703ins81 n/a
5 ccsbBroad304_15838 pLX_304 0% 88.4% 88.4% V5 1_129del;1275T>C;1702_1703ins81 n/a
6 TRCN0000477125 ATTACAACTCCCTTTCCAAACAGC pLX_317 21.7% 88.4% 88.4% V5 1_129del;1275T>C;1702_1703ins81 n/a
Download CSV