Transcript: Human XM_006724664.1

PREDICTED: Homo sapiens TATA-box binding protein associated factor 7 like (TAF7L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAF7L (54457)
Length:
2353
CDS:
26..1417

Additional Resources:

NCBI RefSeq record:
XM_006724664.1
NBCI Gene record:
TAF7L (54457)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015064 GCCTCTACTGATCCTAATATA pLKO.1 617 CDS 100% 15.000 21.000 N TAF7L n/a
2 TRCN0000015066 CCTGACACTCAAGAATCATTT pLKO.1 1300 CDS 100% 13.200 9.240 N TAF7L n/a
3 TRCN0000015063 GCTCCATAAGATTCAGAATAA pLKO.1 1240 CDS 100% 13.200 9.240 N TAF7L n/a
4 TRCN0000015065 GTCAAGATGAAGGATAAACTA pLKO.1 392 CDS 100% 5.625 3.938 N TAF7L n/a
5 TRCN0000015067 GCAGTTGTTGAAGTAGAAGAT pLKO.1 443 CDS 100% 4.950 3.465 N TAF7L n/a
6 TRCN0000425700 ATCTCATCATGAAAGTGGAAA pLKO_005 1278 CDS 100% 4.950 2.475 Y TAF7L n/a
7 TRCN0000428082 GAGGATGAGGATGAGGATGAA pLKO_005 1061 CDS 100% 4.950 2.475 Y TAF7L n/a
8 TRCN0000153022 GATGAGGATGAGGATGAAGAT pLKO.1 1064 CDS 100% 4.950 2.475 Y OS9 n/a
9 TRCN0000420925 GATGATGAGGATGAGGATGAT pLKO_005 1028 CDS 100% 4.950 2.475 Y TAF7L n/a
10 TRCN0000426897 TGAGGATGAAGATGAAGACAA pLKO_005 1072 CDS 100% 4.950 2.475 Y TAF7L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08377 pDONR223 100% 99.7% 99.5% None 101T>C;948_950delAGT n/a
2 ccsbBroad304_08377 pLX_304 0% 99.7% 99.5% V5 101T>C;948_950delAGT n/a
3 TRCN0000477699 CCTCCTCACAATAGAAAGGAAAAG pLX_317 28.8% 99.7% 99.5% V5 101T>C;948_950delAGT n/a
Download CSV