Transcript: Human XM_006724936.3

PREDICTED: Homo sapiens proline dehydrogenase 1, mitochondrial (LOC102724788), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102724788 (102724788)
Length:
2140
CDS:
517..1746

Additional Resources:

NCBI RefSeq record:
XM_006724936.3
NBCI Gene record:
LOC102724788 (102724788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724936.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026577 GAGGTGCTTCTTTCACCAAAT pLKO.1 705 CDS 100% 10.800 5.400 Y PRODH n/a
2 TRCN0000026528 GATGACCTTCTATGGGCATTT pLKO.1 338 5UTR 100% 10.800 5.400 Y PRODH n/a
3 TRCN0000026542 GCAGGAAAGTGTCGCAAAGTT pLKO.1 789 CDS 100% 5.625 2.813 Y PRODH n/a
4 TRCN0000432564 CTAGGACAGAGGCTATTCAAC pLKO_005 306 5UTR 100% 4.950 2.475 Y PRODH n/a
5 TRCN0000036692 GCGGAAGTTCAATGTGGAGAA pLKO.1 1137 CDS 100% 4.050 2.025 Y LOC400889 n/a
6 TRCN0000026522 GTGTACAAGTACGTGCCCTAT pLKO.1 1576 CDS 100% 4.050 2.025 Y PRODH n/a
7 TRCN0000026533 CCGCACCTACTTCTACGCCAA pLKO.1 599 CDS 100% 0.720 0.360 Y PRODH n/a
8 TRCN0000036693 GCAGGAAAGTGTCGCAAAGAT pLKO.1 789 CDS 100% 5.625 2.813 Y LOC400889 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724936.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06779 pDONR223 100% 82.7% 69.3% None (many diffs) n/a
2 ccsbBroad304_06779 pLX_304 0% 82.7% 69.3% V5 (many diffs) n/a
3 TRCN0000492052 CGACCCACTTGCTACGAGTGGATC pLX_317 29.3% 82.7% 69.3% V5 (many diffs) n/a
Download CSV