Transcript: Mouse XM_011238670.2

PREDICTED: Mus musculus thyroid hormone receptor interactor 12 (Trip12), transcript variant X24, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trip12 (14897)
Length:
8218
CDS:
259..6357

Additional Resources:

NCBI RefSeq record:
XM_011238670.2
NBCI Gene record:
Trip12 (14897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273210 CCACTACTCAGTCACCTAAAT pLKO_005 3464 CDS 100% 13.200 18.480 N TRIP12 n/a
2 TRCN0000039427 GCTGTATTTGACATCTAAGAA pLKO.1 3873 CDS 100% 5.625 7.875 N Trip12 n/a
3 TRCN0000039426 CCATATAACATGACCGTGTAT pLKO.1 4438 CDS 100% 4.950 6.930 N Trip12 n/a
4 TRCN0000323952 CCATATAACATGACCGTGTAT pLKO_005 4438 CDS 100% 4.950 6.930 N Trip12 n/a
5 TRCN0000039424 GCCCTAAAGCATTGTTGTGAT pLKO.1 6518 3UTR 100% 4.950 3.960 N Trip12 n/a
6 TRCN0000323953 GCCCTAAAGCATTGTTGTGAT pLKO_005 6518 3UTR 100% 4.950 3.960 N Trip12 n/a
7 TRCN0000039425 CGGGCTGTGAAGTTCTTGTTT pLKO.1 6058 CDS 100% 5.625 3.938 N Trip12 n/a
8 TRCN0000324016 CGGGCTGTGAAGTTCTTGTTT pLKO_005 6058 CDS 100% 5.625 3.938 N Trip12 n/a
9 TRCN0000022374 CCTGAGTCAAGGAAACATGTT pLKO.1 6426 3UTR 100% 4.950 3.465 N TRIP12 n/a
10 TRCN0000273135 CCTGAGTCAAGGAAACATGTT pLKO_005 6426 3UTR 100% 4.950 3.465 N TRIP12 n/a
11 TRCN0000039428 GCAGGATAAATCCCAGACCAA pLKO.1 5667 CDS 100% 2.640 1.848 N Trip12 n/a
12 TRCN0000324017 GCAGGATAAATCCCAGACCAA pLKO_005 5667 CDS 100% 2.640 1.848 N Trip12 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7537 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.