Transcript: Mouse XM_011238748.2

PREDICTED: Mus musculus coatomer protein complex subunit alpha (Copa), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Copa (12847)
Length:
3710
CDS:
485..3142

Additional Resources:

NCBI RefSeq record:
XM_011238748.2
NBCI Gene record:
Copa (12847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313321 ATAGTTACCCTAATCGCAATT pLKO_005 2406 CDS 100% 10.800 15.120 N Copa n/a
2 TRCN0000113146 GCATTATGTAAAGGACCGATT pLKO.1 325 5UTR 100% 4.050 5.670 N Copa n/a
3 TRCN0000379921 ACAAGCAACCACATCAAATAT pLKO_005 1100 CDS 100% 15.000 10.500 N COPA n/a
4 TRCN0000313322 ATGCCTGCCAGCTCAATTATG pLKO_005 2928 CDS 100% 13.200 9.240 N Copa n/a
5 TRCN0000113147 CCAACGCAAATCTGGTGCAAT pLKO.1 2213 CDS 100% 4.950 3.465 N Copa n/a
6 TRCN0000113145 CCAGTACGAGACAGAAGGATT pLKO.1 3454 3UTR 100% 4.950 3.465 N Copa n/a
7 TRCN0000349438 CCAGTACGAGACAGAAGGATT pLKO_005 3454 3UTR 100% 4.950 3.465 N Copa n/a
8 TRCN0000113149 GCACCTATCATGCCATTGGAT pLKO.1 1862 CDS 100% 3.000 2.100 N Copa n/a
9 TRCN0000113148 GCCGTGAATACATTGTGGGTT pLKO.1 2637 CDS 100% 2.640 1.848 N Copa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06019 pDONR223 100% 64.5% 68.7% None (many diffs) n/a
2 ccsbBroad304_06019 pLX_304 0% 64.5% 68.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000479349 CACACTCTCAAGGACTCGCCTTGG pLX_317 14.5% 64.5% 68.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV