Transcript: Mouse XM_011238776.2

PREDICTED: Mus musculus presenilin 2 (Psen2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Psen2 (19165)
Length:
2018
CDS:
103..1449

Additional Resources:

NCBI RefSeq record:
XM_011238776.2
NBCI Gene record:
Psen2 (19165)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285918 TACACTCTAGTGCCATATATT pLKO_005 1511 3UTR 100% 15.000 21.000 N Psen2 n/a
2 TRCN0000030525 GCAGGCTTACCTTATTGTGAT pLKO.1 786 CDS 100% 4.950 3.960 N Psen2 n/a
3 TRCN0000030526 CCACTATCAAGTCTGTGCGTT pLKO.1 413 CDS 100% 2.640 2.112 N Psen2 n/a
4 TRCN0000277246 CCACTATCAAGTCTGTGCGTT pLKO_005 413 CDS 100% 2.640 2.112 N Psen2 n/a
5 TRCN0000030527 GAGAGAAATGAGCCCATATTT pLKO.1 949 CDS 100% 15.000 10.500 N Psen2 n/a
6 TRCN0000320217 GAGAGAAATGAGCCCATATTT pLKO_005 949 CDS 100% 15.000 10.500 N Psen2 n/a
7 TRCN0000277286 CTCCTCAACTCCGTGCTTAAC pLKO_005 505 CDS 100% 10.800 7.560 N Psen2 n/a
8 TRCN0000030528 CCTCGTGGTACTCTACAAGTA pLKO.1 567 CDS 100% 4.950 3.465 N Psen2 n/a
9 TRCN0000073747 CCTCATCATGATCAGCGTCAT pLKO.1 528 CDS 100% 4.050 2.835 N PSEN2 n/a
10 TRCN0000030524 CCTGATATACTCATCTGCCAT pLKO.1 975 CDS 100% 2.640 1.848 N Psen2 n/a
11 TRCN0000277284 CCTGATATACTCATCTGCCAT pLKO_005 975 CDS 100% 2.640 1.848 N Psen2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06789 pDONR223 100% 89.7% 95.9% None (many diffs) n/a
2 ccsbBroad304_06789 pLX_304 0% 89.7% 95.9% V5 (many diffs) n/a
3 TRCN0000492347 ACTATACCAGCGTTGCGTCAAACC pLX_317 29.3% 89.7% 95.9% V5 (many diffs) n/a
Download CSV