Transcript: Mouse XM_011238817.2

PREDICTED: Mus musculus zinc finger and BTB domain containing 37 (Zbtb37), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb37 (240869)
Length:
3719
CDS:
85..1599

Additional Resources:

NCBI RefSeq record:
XM_011238817.2
NBCI Gene record:
Zbtb37 (240869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167508 GCAGTGAAGTTGACAGATTTA pLKO.1 998 CDS 100% 13.200 18.480 N ZBTB37 n/a
2 TRCN0000099522 CCAGGTAGAAGAGTCAGCAAT pLKO.1 1110 CDS 100% 4.950 6.930 N Zbtb37 n/a
3 TRCN0000138252 CGGGATCACATGTCCTTGAAT pLKO.1 262 CDS 100% 5.625 4.500 N ZBTB37 n/a
4 TRCN0000426715 CAGTGAAGTTGACAGATTTAG pLKO_005 999 CDS 100% 13.200 9.240 N ZBTB37 n/a
5 TRCN0000418792 TCTGTTACACAGGGCGGATAT pLKO_005 347 CDS 100% 10.800 7.560 N ZBTB37 n/a
6 TRCN0000099524 GCAACTTCTTTCTTTCTGTTA pLKO.1 333 CDS 100% 4.950 3.465 N Zbtb37 n/a
7 TRCN0000099521 GCTCTGTGATATTGTGGTCAA pLKO.1 180 CDS 100% 4.050 2.835 N Zbtb37 n/a
8 TRCN0000099523 GCTGGAATATCACATCCGCAA pLKO.1 1335 CDS 100% 2.160 1.512 N Zbtb37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04403 pDONR223 100% 65.3% 64.1% None (many diffs) n/a
2 ccsbBroad304_04403 pLX_304 0% 65.3% 64.1% V5 (many diffs) n/a
3 TRCN0000474611 GCAAAGCGCCCATACATGCATAAC pLX_317 46.9% 65.3% 64.1% V5 (many diffs) n/a
Download CSV