Transcript: Mouse XM_011238865.2

PREDICTED: Mus musculus SET and MYND domain containing 3 (Smyd3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smyd3 (69726)
Length:
1449
CDS:
16..798

Additional Resources:

NCBI RefSeq record:
XM_011238865.2
NBCI Gene record:
Smyd3 (69726)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123368 GATCTGCAATTCGTTCACTAT pLKO.1 45 CDS 100% 4.950 6.930 N Smyd3 n/a
2 TRCN0000123293 CAGCCTGATTGAAGATTTGAT pLKO.1 735 CDS 100% 5.625 4.500 N SMYD3 n/a
3 TRCN0000289526 CAGCCTGATTGAAGATTTGAT pLKO_005 735 CDS 100% 5.625 4.500 N SMYD3 n/a
4 TRCN0000123292 AGCCTGATTGAAGATTTGATT pLKO.1 736 CDS 100% 5.625 3.938 N SMYD3 n/a
5 TRCN0000123366 GCTTCCCGACATCAACATCTA pLKO.1 468 CDS 100% 4.950 3.465 N Smyd3 n/a
6 TRCN0000123367 GAGCAAATATGGAAGGAGGTT pLKO.1 349 CDS 100% 2.640 1.848 N Smyd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12481 pDONR223 100% 80.8% 87.3% None (many diffs) n/a
2 ccsbBroad304_12481 pLX_304 0% 80.8% 87.3% V5 (many diffs) n/a
3 TRCN0000479013 CTTTCTAGTAATTGAAGCAAACCG pLX_317 48.9% 80.8% 87.3% V5 (many diffs) n/a
4 ccsbBroadEn_08862 pDONR223 100% 52.8% 55.8% None (many diffs) n/a
5 ccsbBroad304_08862 pLX_304 0% 52.8% 55.8% V5 (many diffs) n/a
6 TRCN0000473342 TGCATATGGCCGTAGACGGCTAGT pLX_317 38.4% 52.8% 55.8% V5 (many diffs) n/a
Download CSV