Transcript: Mouse XM_011238890.2

PREDICTED: Mus musculus cornichon family AMPA receptor auxiliary protein 4 (Cnih4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnih4 (98417)
Length:
993
CDS:
649..993

Additional Resources:

NCBI RefSeq record:
XM_011238890.2
NBCI Gene record:
Cnih4 (98417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238890.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174324 CGTCTACTTCATCATTACATT pLKO.1 708 CDS 100% 5.625 4.500 N Cnih4 n/a
2 TRCN0000176170 GATTACATTAACGCCAGATCA pLKO.1 745 CDS 100% 4.950 3.465 N Cnih4 n/a
3 TRCN0000174517 CTTCATCATTACATTGTCTGA pLKO.1 714 CDS 100% 2.640 1.848 N Cnih4 n/a
4 TRCN0000149322 GTCACACATGAAAGAAGCCAT pLKO.1 925 CDS 100% 2.640 1.848 N CNIH4 n/a
5 TRCN0000339013 GTCACACATGAAAGAAGCCAT pLKO_005 925 CDS 100% 2.640 1.848 N CNIH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238890.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08111 pDONR223 100% 73.6% 59.8% None (many diffs) n/a
2 ccsbBroad304_08111 pLX_304 0% 73.6% 59.8% V5 (many diffs) n/a
3 TRCN0000471048 TCACCACTGCGTTAATACACGGCA pLX_317 83.9% 73.6% 59.8% V5 (many diffs) n/a
Download CSV