Transcript: Mouse XM_011239244.1

PREDICTED: Mus musculus diacylglycerol kinase zeta (Dgkz), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dgkz (104418)
Length:
6423
CDS:
4299..6377

Additional Resources:

NCBI RefSeq record:
XM_011239244.1
NBCI Gene record:
Dgkz (104418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239244.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025396 CCTGGATGTCTTTAACAACTA pLKO.1 6226 CDS 100% 4.950 3.465 N Dgkz n/a
2 TRCN0000278613 CCTGGATGTCTTTAACAACTA pLKO_005 6226 CDS 100% 4.950 3.465 N Dgkz n/a
3 TRCN0000025395 CCTGTAAGATCGTGGTGCATA pLKO.1 5278 CDS 100% 4.950 3.465 N Dgkz n/a
4 TRCN0000278614 CCTGTAAGATCGTGGTGCATA pLKO_005 5278 CDS 100% 4.950 3.465 N Dgkz n/a
5 TRCN0000196402 GCTTTCGGAATAAGATGTTCT pLKO.1 6327 CDS 100% 4.950 3.465 N DGKZ n/a
6 TRCN0000025398 GAGAAGTTCAACAGCCGCTTT pLKO.1 6311 CDS 100% 4.050 2.835 N Dgkz n/a
7 TRCN0000278690 GAGAAGTTCAACAGCCGCTTT pLKO_005 6311 CDS 100% 4.050 2.835 N Dgkz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239244.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14900 pDONR223 58.3% 37.8% 30.1% None (many diffs) n/a
2 ccsbBroad304_14900 pLX_304 0% 37.8% 30.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_07252 pDONR223 100% 38% 30.2% None (many diffs) n/a
4 ccsbBroad304_07252 pLX_304 0% 38% 30.2% V5 (many diffs) n/a
5 TRCN0000477876 CTTCAGCCTTCAAATAGGAGTGCC pLX_317 11.2% 38% 30.2% V5 (many diffs) n/a
Download CSV