Transcript: Mouse XM_011239427.2

PREDICTED: Mus musculus sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (Sema6d), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sema6d (214968)
Length:
6257
CDS:
630..3794

Additional Resources:

NCBI RefSeq record:
XM_011239427.2
NBCI Gene record:
Sema6d (214968)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000453406 GAGCGCTACGGATCGTGTAAA pLKO_005 2175 CDS 100% 13.200 18.480 N Sema6d n/a
2 TRCN0000112325 GCCACCAACAAACTATGTTAA pLKO.1 4366 3UTR 100% 13.200 18.480 N Sema6d n/a
3 TRCN0000112327 CGGTTGACTATCACTATTCAA pLKO.1 724 CDS 100% 5.625 7.875 N Sema6d n/a
4 TRCN0000112328 GCCATAGAATATGGAAACTAT pLKO.1 1305 CDS 100% 5.625 4.500 N Sema6d n/a
5 TRCN0000112326 GCAGTCTATAACAGACATAAT pLKO.1 1520 CDS 100% 13.200 9.240 N Sema6d n/a
6 TRCN0000450080 GGATCTGCCCTTCGCACAATA pLKO_005 1242 CDS 100% 13.200 9.240 N Sema6d n/a
7 TRCN0000112329 GCCACCAAACACGGATACAAA pLKO.1 2816 CDS 100% 5.625 3.938 N Sema6d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04171 pDONR223 100% 82.7% 89% None (many diffs) n/a
2 ccsbBroad304_04171 pLX_304 0% 82.7% 89% V5 (many diffs) n/a
3 TRCN0000475909 ACCAAGAGATGATGTTGTTTATAG pLX_317 10.6% 82.7% 89% V5 (many diffs) n/a
Download CSV