Transcript: Mouse XM_011239707.2

PREDICTED: Mus musculus ubiquinol-cytochrome c reductase complex assembly factor 1 (Uqcc1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uqcc1 (56046)
Length:
879
CDS:
289..819

Additional Resources:

NCBI RefSeq record:
XM_011239707.2
NBCI Gene record:
Uqcc1 (56046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189674 GCAGCAATCTTGGGATACGAT pLKO.1 855 3UTR 100% 3.000 4.200 N Uqcc1 n/a
2 TRCN0000328955 GCAGCAATCTTGGGATACGAT pLKO_005 855 3UTR 100% 3.000 4.200 N Uqcc1 n/a
3 TRCN0000192391 CGATACATTCAACTCCTGGTT pLKO.1 756 CDS 100% 2.640 3.696 N Uqcc1 n/a
4 TRCN0000328953 CGATACATTCAACTCCTGGTT pLKO_005 756 CDS 100% 2.640 3.696 N Uqcc1 n/a
5 TRCN0000202241 GAAGACTGACTTCGAGGAGTT pLKO.1 714 CDS 100% 4.050 2.835 N Uqcc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239707.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08495 pDONR223 100% 41.7% 37.6% None (many diffs) n/a
2 ccsbBroad304_08495 pLX_304 0% 41.7% 37.6% V5 (many diffs) n/a
3 TRCN0000480068 AGGCTCTTTTCCCGTCTAAGCATA pLX_317 19.1% 41.7% 37.6% V5 (many diffs) n/a
Download CSV