Transcript: Mouse XM_011239711.2

PREDICTED: Mus musculus Rap guanine nucleotide exchange factor (GEF) 4 (Rapgef4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rapgef4 (56508)
Length:
3691
CDS:
76..2595

Additional Resources:

NCBI RefSeq record:
XM_011239711.2
NBCI Gene record:
Rapgef4 (56508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239711.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000448487 GAGTTATGTACGGCAATTAAA pLKO_005 2511 CDS 100% 15.000 21.000 N Rapgef4 n/a
2 TRCN0000448585 GGATGCCGCTCAAGCTAATAA pLKO_005 2472 CDS 100% 15.000 21.000 N Rapgef4 n/a
3 TRCN0000047660 CGGAGTTATGTACGGCAATTA pLKO.1 2509 CDS 100% 13.200 18.480 N RAPGEF4 n/a
4 TRCN0000110003 CTCCTTCATATTAAAGCCTTA pLKO.1 610 CDS 100% 4.050 5.670 N Rapgef4 n/a
5 TRCN0000110002 GCTCCTTCATATTAAAGCCTT pLKO.1 609 CDS 100% 2.640 3.696 N Rapgef4 n/a
6 TRCN0000452055 CACATTTGGAAGGCATAATTT pLKO_005 1956 CDS 100% 15.000 10.500 N Rapgef4 n/a
7 TRCN0000444485 GTTCATTGACAATCTAGTAAA pLKO_005 2379 CDS 100% 13.200 9.240 N Rapgef4 n/a
8 TRCN0000454212 GCCTTGAGCCATCGTTGAATG pLKO_005 1109 CDS 100% 10.800 7.560 N Rapgef4 n/a
9 TRCN0000110004 GTGGTGCTGAAATCTAATGAT pLKO.1 1720 CDS 100% 5.625 3.938 N Rapgef4 n/a
10 TRCN0000110001 GCCGAGCAAGTTTAAGAAGTT pLKO.1 2214 CDS 100% 4.950 3.465 N Rapgef4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239711.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07741 pDONR223 100% 88.2% 92.7% None (many diffs) n/a
2 ccsbBroad304_07741 pLX_304 0% 88.2% 92.7% V5 (many diffs) n/a
3 TRCN0000481153 CTTAATTACAAGATTCTCTGTCCT pLX_317 17.8% 88.2% 92.7% V5 (many diffs) n/a
Download CSV