Transcript: Mouse XM_011239712.1

PREDICTED: Mus musculus N-terminal EF-hand calcium binding protein 3 (Necab3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Necab3 (56846)
Length:
2296
CDS:
396..1556

Additional Resources:

NCBI RefSeq record:
XM_011239712.1
NBCI Gene record:
Necab3 (56846)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120004 CCTGGTGGATTATGAATAATA pLKO.1 1531 CDS 100% 15.000 12.000 N Necab3 n/a
2 TRCN0000054081 CTGTATGAGTTCTGGCAGGAT pLKO.1 1398 CDS 100% 2.640 2.112 N NECAB3 n/a
3 TRCN0000120003 GACCAGTTTGTCACACGATTT pLKO.1 843 CDS 100% 10.800 7.560 N Necab3 n/a
4 TRCN0000120002 GCCTATCATTTGCATGTCTTA pLKO.1 2105 3UTR 100% 4.950 3.465 N Necab3 n/a
5 TRCN0000120006 TCGTGCTTTGTGCTGCTACAT pLKO.1 1304 CDS 100% 4.950 3.465 N Necab3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14241 pDONR223 100% 63.2% 5.5% None (many diffs) n/a
2 ccsbBroad304_14241 pLX_304 0% 63.2% 5.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481233 CCATCTCGTGTCTATCCTCCGCCG pLX_317 35.6% 63.2% 5.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV