Transcript: Mouse XM_011240087.2

PREDICTED: Mus musculus Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) (Smg5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smg5 (229512)
Length:
4141
CDS:
330..3185

Additional Resources:

NCBI RefSeq record:
XM_011240087.2
NBCI Gene record:
Smg5 (229512)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251190 GGAACCTCAAGAGACTATATG pLKO_005 880 CDS 100% 13.200 10.560 N Smg5 n/a
2 TRCN0000265336 AGAGCTTTGAGCGGCATAAAC pLKO_005 2917 CDS 100% 13.200 9.240 N Smg5 n/a
3 TRCN0000251193 AGTGGCATGGTGACCATTATC pLKO_005 3033 CDS 100% 13.200 9.240 N Smg5 n/a
4 TRCN0000251192 GGCTGCTCATAGACGCTTTAA pLKO_005 2357 CDS 100% 13.200 9.240 N Smg5 n/a
5 TRCN0000251191 CTTGGCTGCTGTACTGGATAA pLKO_005 3876 3UTR 100% 10.800 7.560 N Smg5 n/a
6 TRCN0000130550 GCTGTGGAGAAAGGTATACTA pLKO.1 374 CDS 100% 5.625 3.938 N SMG5 n/a
7 TRCN0000127791 GAAAGAGCTTTGAGCGGCATA pLKO.1 2914 CDS 100% 4.050 2.835 N SMG5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07874 pDONR223 100% 82.6% 86.9% None (many diffs) n/a
2 ccsbBroad304_07874 pLX_304 0% 82.6% 86.9% V5 (many diffs) n/a
3 TRCN0000481541 CCTGCTTCGCTACTTTACTCATCA pLX_317 13.5% 82.6% 86.9% V5 (many diffs) n/a
Download CSV