Transcript: Mouse XM_011240199.2

PREDICTED: Mus musculus PRP38 pre-mRNA processing factor 38 (yeast) domain containing B (Prpf38b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prpf38b (66921)
Length:
4017
CDS:
1871..2905

Additional Resources:

NCBI RefSeq record:
XM_011240199.2
NBCI Gene record:
Prpf38b (66921)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240199.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294676 GATCACATTGAATCCTATAAA pLKO_005 2922 3UTR 100% 15.000 21.000 N Prpf38b n/a
2 TRCN0000123600 CGAAGACGAGACCGAGATTAT pLKO.1 2369 CDS 100% 13.200 18.480 N Prpf38b n/a
3 TRCN0000298308 CGAAGACGAGACCGAGATTAT pLKO_005 2369 CDS 100% 13.200 18.480 N Prpf38b n/a
4 TRCN0000123599 GCCCTATACTAAGGAGTGATT pLKO.1 3663 3UTR 100% 4.950 3.960 N Prpf38b n/a
5 TRCN0000123603 CCATTGGAGAGATGCTTCGTT pLKO.1 1875 CDS 100% 3.000 2.400 N Prpf38b n/a
6 TRCN0000123602 CCAGTCCAGAAGAACATTGAT pLKO.1 1949 CDS 100% 5.625 3.938 N Prpf38b n/a
7 TRCN0000294733 AGCAAGGAGAAGGCAAATAAA pLKO_005 2654 CDS 100% 15.000 9.000 N Prpf38b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240199.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.