Transcript: Mouse XM_011240215.2

PREDICTED: Mus musculus nexilin (Nexn), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nexn (68810)
Length:
3193
CDS:
509..2521

Additional Resources:

NCBI RefSeq record:
XM_011240215.2
NBCI Gene record:
Nexn (68810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240215.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114148 GCATGGTATTAGATGATGATT pLKO.1 1542 CDS 100% 5.625 7.875 N Nexn n/a
2 TRCN0000114147 GCCGGAAATTACATGGTGGTT pLKO.1 2323 CDS 100% 2.640 3.696 N Nexn n/a
3 TRCN0000114146 GCATGAATAAACTGGAGATTT pLKO.1 2869 3UTR 100% 13.200 9.240 N Nexn n/a
4 TRCN0000114150 CCAAAGCTAACAGGGACAGTT pLKO.1 794 CDS 100% 4.950 3.465 N Nexn n/a
5 TRCN0000114149 CCGAGTTCTCAAAGAAGCAAA pLKO.1 1147 CDS 100% 4.950 3.465 N Nexn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240215.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12965 pDONR223 100% 73.6% 74.6% None (many diffs) n/a
2 ccsbBroad304_12965 pLX_304 0% 73.6% 74.6% V5 (many diffs) n/a
3 TRCN0000469025 GACGATTCATCCAGGCGCGGTGTG pLX_317 27.2% 73.6% 74.6% V5 (many diffs) n/a
4 ccsbBroadEn_12966 pDONR223 100% 71.4% 71.8% None (many diffs) n/a
5 ccsbBroad304_12966 pLX_304 0% 71.4% 71.8% V5 (many diffs) n/a
6 TRCN0000480865 TCTTTGGATCACGCATAGGCGATG pLX_317 22.9% 71.4% 71.8% V5 (many diffs) n/a
Download CSV