Transcript: Mouse XM_011240435.2

PREDICTED: Mus musculus disabled 1 (Dab1), transcript variant X19, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dab1 (13131)
Length:
5578
CDS:
675..2231

Additional Resources:

NCBI RefSeq record:
XM_011240435.2
NBCI Gene record:
Dab1 (13131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240435.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197728 GATCTCTTTCAACTCATCTAT pLKO.1 1140 CDS 100% 5.625 3.938 N Dab1 n/a
2 TRCN0000182621 GCAGTGTGAACAAGCTGTGTA pLKO.1 1208 CDS 100% 4.950 3.465 N Dab1 n/a
3 TRCN0000063951 GCCACTTTGATAAAGAGGTTT pLKO.1 759 CDS 100% 4.950 3.465 N DAB1 n/a
4 TRCN0000177332 GCCACTTTGATAAAGAGGTTT pLKO.1 759 CDS 100% 4.950 3.465 N Dab1 n/a
5 TRCN0000177311 GTTATGTCAAGATTCCATGAT pLKO.1 851 CDS 100% 4.950 3.465 N Dab1 n/a
6 TRCN0000063949 CCACACAAACTGTTATGCCTT pLKO.1 1666 CDS 100% 2.640 1.848 N DAB1 n/a
7 TRCN0000182772 CTTCAGCATCACCATGCTGTT pLKO.1 984 CDS 100% 0.405 0.284 N Dab1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240435.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15394 pDONR223 0% 80.6% 74.6% None (many diffs) n/a
2 ccsbBroad304_15394 pLX_304 0% 80.6% 74.6% V5 (many diffs) n/a
Download CSV