Transcript: Mouse XM_011240502.2

PREDICTED: Mus musculus guanine nucleotide binding protein-like 2 (nucleolar) (Gnl2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gnl2 (230737)
Length:
2165
CDS:
622..2121

Additional Resources:

NCBI RefSeq record:
XM_011240502.2
NBCI Gene record:
Gnl2 (230737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103870 CGTCAGAATATCCAAGGACTT pLKO.1 1797 CDS 100% 4.050 5.670 N Gnl2 n/a
2 TRCN0000323949 CGTCAGAATATCCAAGGACTT pLKO_005 1797 CDS 100% 4.050 5.670 N Gnl2 n/a
3 TRCN0000103871 CGCCTGAATATGTACAGGCAA pLKO.1 259 5UTR 100% 0.264 0.370 N Gnl2 n/a
4 TRCN0000324014 CGCCTGAATATGTACAGGCAA pLKO_005 259 5UTR 100% 0.264 0.370 N Gnl2 n/a
5 TRCN0000293756 TTCAGCTTCTGCGGCAGTTTG pLKO_005 818 CDS 100% 10.800 7.560 N GNL2 n/a
6 TRCN0000103872 CATTGGAAGTTCCCACAGAAA pLKO.1 1367 CDS 100% 4.950 3.465 N Gnl2 n/a
7 TRCN0000323950 CATTGGAAGTTCCCACAGAAA pLKO_005 1367 CDS 100% 4.950 3.465 N Gnl2 n/a
8 TRCN0000103873 CCATTGGAAGTTCCCACAGAA pLKO.1 1366 CDS 100% 4.950 3.465 N Gnl2 n/a
9 TRCN0000103874 GCAAGTGATATGCAATCCCTT pLKO.1 470 5UTR 100% 2.640 1.848 N Gnl2 n/a
10 TRCN0000324015 GCAAGTGATATGCAATCCCTT pLKO_005 470 5UTR 100% 2.640 1.848 N Gnl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03098 pDONR223 100% 56.9% 56.4% None (many diffs) n/a
2 ccsbBroad304_03098 pLX_304 0% 56.9% 56.4% V5 (many diffs) n/a
3 TRCN0000481021 CTGTCAGCAAGAATCATGGTGATC pLX_317 20.4% 56.9% 56.4% V5 (many diffs) n/a
Download CSV