Transcript: Mouse XM_011240511.1

PREDICTED: Mus musculus adhesion G protein-coupled receptor B2 (Adgrb2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrb2 (230775)
Length:
4894
CDS:
16..4599

Additional Resources:

NCBI RefSeq record:
XM_011240511.1
NBCI Gene record:
Adgrb2 (230775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415485 TGCACTTCGACAAGAACTTTG pLKO_005 440 CDS 100% 10.800 15.120 N Adgrb2 n/a
2 TRCN0000112158 CGGGATTATCGTCTTCAACAA pLKO.1 3114 CDS 100% 4.950 6.930 N Adgrb2 n/a
3 TRCN0000112156 GCACCAAAGGATATGGTACAT pLKO.1 3005 CDS 100% 4.950 6.930 N Adgrb2 n/a
4 TRCN0000425302 TGACCTGTTCACCACCGAGAT pLKO_005 798 CDS 100% 4.050 3.240 N Adgrb2 n/a
5 TRCN0000426967 ACCACTACCTGGTCAACTTTA pLKO_005 281 CDS 100% 13.200 9.240 N Adgrb2 n/a
6 TRCN0000112155 CCAGCTTTGCTCGTTGCATAT pLKO.1 1568 CDS 100% 10.800 7.560 N Adgrb2 n/a
7 TRCN0000112157 CCACGAACTCAACCAGAAGTT pLKO.1 4350 CDS 100% 4.950 3.465 N Adgrb2 n/a
8 TRCN0000112159 GCAGACTAAACTCTGCAGTAT pLKO.1 1041 CDS 100% 0.495 0.347 N Adgrb2 n/a
9 TRCN0000430321 GGGATATGGCTCTCAACTGTG pLKO_005 3306 CDS 100% 4.050 2.430 N Adgrb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489289 GCCGTAGACCGTAGGTACGATGTC pLX_317 7.6% 85% 90% V5 (many diffs) n/a
2 TRCN0000488242 GACCACCCAAAAAAGACTATCCAT pLX_317 7.4% 85.1% 90.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV