Transcript: Mouse XM_011240573.1

PREDICTED: Mus musculus enoyl Coenzyme A hydratase domain containing 2 (Echdc2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Echdc2 (52430)
Length:
1382
CDS:
483..1058

Additional Resources:

NCBI RefSeq record:
XM_011240573.1
NBCI Gene record:
Echdc2 (52430)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258028 CGTGAGTTGGGCCTGGTAAAT pLKO_005 783 CDS 100% 13.200 18.480 N Echdc2 n/a
2 TRCN0000179561 GCCATAGAACAGATGTGCTAT pLKO.1 954 CDS 100% 4.950 6.930 N Echdc2 n/a
3 TRCN0000250369 GAGAAACGAGCTCCCAAATTT pLKO_005 1026 CDS 100% 15.000 10.500 N Echdc2 n/a
4 TRCN0000258036 CAAGTGACCCAGCTAACTTTA pLKO_005 1052 CDS 100% 13.200 9.240 N Echdc2 n/a
5 TRCN0000250370 GAGGAATGGAGGTGGACATTG pLKO_005 922 CDS 100% 10.800 7.560 N Echdc2 n/a
6 TRCN0000250368 CACACCATAAAGTCTAGATCA pLKO_005 1077 3UTR 100% 4.950 3.465 N Echdc2 n/a
7 TRCN0000195893 CTCCCAAATTTGTGGGCAAGT pLKO.1 1036 CDS 100% 4.050 2.835 N Echdc2 n/a
8 TRCN0000216085 CTTTAAGCACACACCATAAAG pLKO.1 1068 3UTR 100% 1.320 0.924 N Echdc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08500 pDONR223 100% 55.6% 58.9% None (many diffs) n/a
2 ccsbBroad304_08500 pLX_304 0% 55.6% 58.9% V5 (many diffs) n/a
3 TRCN0000468030 CATCTCCCAAGAGGATTAGTACTA pLX_317 49.3% 55.6% 58.9% V5 (many diffs) n/a
Download CSV