Transcript: Mouse XM_011240621.2

PREDICTED: Mus musculus kinesin family member 2C (Kif2c), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif2c (73804)
Length:
2852
CDS:
298..2319

Additional Resources:

NCBI RefSeq record:
XM_011240621.2
NBCI Gene record:
Kif2c (73804)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240621.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090546 GCCCGGATGATCAAAGAATTT pLKO.1 838 CDS 100% 13.200 18.480 N Kif2c n/a
2 TRCN0000309554 GCCCGGATGATCAAAGAATTT pLKO_005 838 CDS 100% 13.200 18.480 N Kif2c n/a
3 TRCN0000090545 GCTCCTGTGAATACACCTTAA pLKO.1 1850 CDS 100% 10.800 7.560 N Kif2c n/a
4 TRCN0000309645 GCTCCTGTGAATACACCTTAA pLKO_005 1850 CDS 100% 10.800 7.560 N Kif2c n/a
5 TRCN0000090544 CCTGGAAGTTTATGTGACATT pLKO.1 1323 CDS 100% 4.950 3.465 N Kif2c n/a
6 TRCN0000309620 CCTGGAAGTTTATGTGACATT pLKO_005 1323 CDS 100% 4.950 3.465 N Kif2c n/a
7 TRCN0000090543 GCTTTGGTTAGGAACTGAGTT pLKO.1 2393 3UTR 100% 4.950 3.465 N Kif2c n/a
8 TRCN0000309618 GCTTTGGTTAGGAACTGAGTT pLKO_005 2393 3UTR 100% 4.950 3.465 N Kif2c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240621.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02592 pDONR223 100% 80.5% 81.4% None (many diffs) n/a
2 ccsbBroad304_02592 pLX_304 0% 80.5% 81.4% V5 (many diffs) n/a
3 TRCN0000480440 TACGACTGACCCATACTCTTCGAT pLX_317 20.5% 80.5% 81.4% V5 (many diffs) n/a
4 TRCN0000492255 CGGCCTCCTGGCAGCAATACTTCG pLX_317 4.6% 80.5% 81.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_07722 pDONR223 100% 80.5% 81.3% None (many diffs) n/a
6 ccsbBroad304_07722 pLX_304 0% 80.5% 81.3% V5 (many diffs) n/a
Download CSV