Transcript: Mouse XM_011240655.2

PREDICTED: Mus musculus ATP/GTP binding protein-like 4 (Agbl4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Agbl4 (78933)
Length:
1693
CDS:
316..1599

Additional Resources:

NCBI RefSeq record:
XM_011240655.2
NBCI Gene record:
Agbl4 (78933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240655.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347379 TGGAGTGAAACAGCTTATTAT pLKO_005 888 CDS 100% 15.000 10.500 N Agbl4 n/a
2 TRCN0000254793 CTACACTGAAGAAGCCTATAT pLKO_005 1227 CDS 100% 13.200 9.240 N Agbl4 n/a
3 TRCN0000254792 GTTCTGGTAAAGCACTCAATG pLKO_005 1427 CDS 100% 10.800 7.560 N Agbl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240655.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12867 pDONR223 100% 53.3% 53.5% None (many diffs) n/a
2 ccsbBroad304_12867 pLX_304 0% 53.3% 53.5% V5 (many diffs) n/a
3 TRCN0000465668 TAATGTTGACCACCACCGTGTAGT pLX_317 35.6% 53.3% 53.5% V5 (many diffs) n/a
Download CSV